ID: 927960243

View in Genome Browser
Species Human (GRCh38)
Location 2:27236763-27236785
Sequence CGGGCCAGCCCCTCCTTTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927960240_927960243 -10 Left 927960240 2:27236750-27236772 CCCTAGGCCAGATCGGGCCAGCC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 927960243 2:27236763-27236785 CGGGCCAGCCCCTCCTTTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 128
927960231_927960243 26 Left 927960231 2:27236714-27236736 CCCTTCCCTTAAAGCTGACTGCT 0: 1
1: 0
2: 1
3: 19
4: 170
Right 927960243 2:27236763-27236785 CGGGCCAGCCCCTCCTTTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 128
927960237_927960243 1 Left 927960237 2:27236739-27236761 CCACTTGCAGGCCCTAGGCCAGA 0: 1
1: 0
2: 0
3: 19
4: 168
Right 927960243 2:27236763-27236785 CGGGCCAGCCCCTCCTTTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 128
927960232_927960243 25 Left 927960232 2:27236715-27236737 CCTTCCCTTAAAGCTGACTGCTT 0: 1
1: 0
2: 0
3: 18
4: 174
Right 927960243 2:27236763-27236785 CGGGCCAGCCCCTCCTTTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 128
927960233_927960243 21 Left 927960233 2:27236719-27236741 CCCTTAAAGCTGACTGCTTTCCA 0: 1
1: 0
2: 3
3: 23
4: 229
Right 927960243 2:27236763-27236785 CGGGCCAGCCCCTCCTTTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 128
927960234_927960243 20 Left 927960234 2:27236720-27236742 CCTTAAAGCTGACTGCTTTCCAC 0: 1
1: 0
2: 0
3: 9
4: 162
Right 927960243 2:27236763-27236785 CGGGCCAGCCCCTCCTTTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927960243 Original CRISPR CGGGCCAGCCCCTCCTTTGA AGG Exonic
900736769 1:4304085-4304107 CAGGCCAGTCCCTACTTTGAGGG - Intergenic
901393686 1:8964817-8964839 CGCGCCAGACCACCCTTTGAAGG - Intronic
901539564 1:9907055-9907077 CAGGCCAGCCCCTTCTTTTATGG - Intronic
901674096 1:10872878-10872900 TGCCCCAGCCCCTCCCTTGATGG - Intergenic
905792729 1:40798932-40798954 CCTGCCAGCCCCTCCCTTGTTGG + Intronic
909113847 1:71509849-71509871 CTGGCTAGCCACCCCTTTGAGGG - Intronic
910337989 1:86155615-86155637 CGGGCCTGCCCCTCCTGCGGAGG - Intronic
913212397 1:116592415-116592437 GAGGCCAGGCCCTGCTTTGAGGG + Intronic
914432346 1:147630263-147630285 CGGGTCAGCCCCTCATGAGAGGG - Intronic
914852970 1:151328301-151328323 CTGTCCAGCCCCTCCCTGGAGGG - Intergenic
915065354 1:153220077-153220099 CGGGACAGCCCCTCCTTGTAGGG + Intergenic
915513391 1:156399467-156399489 CTGGCCAGTCCTTCCTTTAATGG - Intergenic
922894187 1:229088069-229088091 CGGGCCAGCCCCTCCCACGCCGG + Intergenic
923268655 1:232335422-232335444 AGGGCCAGCCCCTCCTTGTCAGG + Intergenic
1065551421 10:26871782-26871804 GTGCCCAGCCCCTGCTTTGATGG + Intergenic
1066233882 10:33466954-33466976 CAGATCATCCCCTCCTTTGAGGG + Intergenic
1069841337 10:71341210-71341232 GGGGTCAGCTCCTCCTTTGGTGG + Intronic
1069863198 10:71483959-71483981 AGACCCAGCACCTCCTTTGAAGG - Intronic
1069881795 10:71597911-71597933 TGGGCCTACCCCGCCTTTGAGGG - Intronic
1070337968 10:75471810-75471832 CAGGCCAGCTGCTCCTTTTAGGG - Intronic
1070826601 10:79393891-79393913 AGGGCCAGCTCCTCCTAGGAAGG - Intronic
1070959747 10:80490305-80490327 TGGTCCAGCCCTTCCTCTGATGG - Intronic
1073073246 10:100807975-100807997 TCGGCCAGCTCCTCCTTTGTTGG - Intronic
1075975429 10:126689935-126689957 AGGTCCAGCCCCACCTTGGAGGG + Intergenic
1076649300 10:131976732-131976754 CAGGGCAGCCCCTCCTAGGAGGG - Intronic
1076887562 10:133269612-133269634 CGGGCCAGCCCCACCCCCGAGGG + Intronic
1077043037 11:532958-532980 CGGGCCACCCTGACCTTTGAGGG - Intronic
1077131325 11:974176-974198 CGGGCCACCCACTCCCTTCATGG - Intronic
1077131337 11:974220-974242 CGGGCCACCCACTCCCTTCATGG - Intronic
1083161047 11:60854328-60854350 GGAACCAGCCCCTCCTCTGATGG + Intronic
1083881137 11:65548829-65548851 CTTAACAGCCCCTCCTTTGAGGG + Intronic
1084000818 11:66294514-66294536 CCGGCCAGCCCCTGCTCCGATGG + Exonic
1084022568 11:66426371-66426393 CGGGCCAGCCCGTGCCCTGAGGG + Exonic
1084154779 11:67307461-67307483 CAGGCCAGCCTCTCCTTCGAAGG + Intronic
1088819923 11:113448292-113448314 TGGGGCAGCCGCTCCTTGGAAGG + Intronic
1088994479 11:114984750-114984772 CTGGCCATCCCCACCTCTGAGGG + Intergenic
1089883260 11:121795090-121795112 AGGGCTAGCCCCTCCTCAGACGG + Intergenic
1092441990 12:8512547-8512569 TGCACCAGCTCCTCCTTTGATGG - Intronic
1096829574 12:54303929-54303951 GGAACCATCCCCTCCTTTGAGGG - Intronic
1105215643 13:18283038-18283060 GGGACCAGGCCCTGCTTTGAGGG + Intergenic
1105894914 13:24709510-24709532 CGGGGCAGGCCCTCGTGTGATGG - Intronic
1106603730 13:31208925-31208947 CGGGTCACCCCCTCCTCAGAGGG + Intronic
1115850810 14:37588514-37588536 AGGCCCAGCCCCTGCTTTGTGGG - Intergenic
1119620060 14:76125312-76125334 TGGCCTAGCCCCTCCTTGGATGG - Intergenic
1119756163 14:77121207-77121229 GGGGCCTGCCCTTCATTTGAGGG + Intronic
1120546755 14:85821132-85821154 TGGGCCAGCCTTTCCTTTTAGGG + Intergenic
1121001820 14:90456602-90456624 CGGACCAACCCCTTCTTTGCAGG + Intergenic
1122274986 14:100586814-100586836 AGGGCCAGCCCCTGCTTGGGAGG - Intronic
1122362502 14:101175724-101175746 AGGTCCAGGCCCTCCTTTAAGGG - Intergenic
1122692774 14:103539041-103539063 CTGGCCTGCCCCCTCTTTGAAGG - Intergenic
1123084879 14:105712775-105712797 CGGCCCAGGCCCTGCCTTGATGG + Intergenic
1131525300 15:93147763-93147785 CTGGCCAACCCCTCCCTGGAAGG + Intergenic
1132038455 15:98505449-98505471 GGGCCCAGCCCCTCCCTTCAAGG + Intronic
1132698960 16:1214147-1214169 CCCGCCAGCCCCTCCTTGGGTGG - Intronic
1132698971 16:1214181-1214203 CCTGCCAGCCCCTCCTTGGGTGG - Intronic
1132825526 16:1903417-1903439 CGGGCCAGCCCCACCTCTTGAGG - Intergenic
1133361682 16:5179062-5179084 CCAGCCAGTCCCTCCTTTCAGGG + Intergenic
1135112916 16:19704674-19704696 CTGGGCACCTCCTCCTTTGATGG - Exonic
1138117132 16:54369721-54369743 CAGGCCAGCCCCTCTTAGGAAGG + Intergenic
1146450932 17:32973323-32973345 CTGGCTAGCCACCCCTTTGAGGG - Intronic
1147265040 17:39229530-39229552 CTGGCCAGCCTCTCCTGGGAAGG + Intergenic
1147554910 17:41472114-41472136 AGAGTCAGCCCATCCTTTGAAGG + Intergenic
1148289282 17:46429203-46429225 TGGGGCAGCCCTTCCTTGGAAGG + Intergenic
1148311451 17:46646775-46646797 TGGGGCAGCCCTTCCTTGGAAGG + Intronic
1150225740 17:63523537-63523559 GGGTCCAGCCCCCCCTTTCACGG - Intronic
1151682420 17:75629045-75629067 GGTGCCTGCCCCTCCTGTGAGGG - Exonic
1151819410 17:76489645-76489667 CTGCCCAGGCCATCCTTTGAGGG + Intronic
1154206440 18:12341165-12341187 GTGGCCACACCCTCCTTTGAAGG + Intronic
1160540819 18:79621537-79621559 AGGCCCATCCCCTCCTCTGAGGG + Intergenic
1160723956 19:609315-609337 CGGGTCAGCCCCTCCTGAGCAGG - Intronic
1161073806 19:2275442-2275464 CTGGCCAGCGCCTCCTGTGTTGG - Exonic
1161962199 19:7529050-7529072 TGGCCCAGCCCTTCCTTTGGGGG - Intronic
1163157235 19:15446121-15446143 GGGGCCAGGCCCACCCTTGAAGG - Intronic
1163725882 19:18922777-18922799 CGGGCCACCTCCTCCTTTGAAGG - Intronic
1165219025 19:34299422-34299444 CGTGCCAGCCTCAGCTTTGAAGG + Intronic
1167402189 19:49280235-49280257 CGGGCCACCCCCTCCTTAGCCGG + Intergenic
1167414125 19:49361549-49361571 CCGGCAAGCCCCTCCCCTGATGG - Intronic
1167539405 19:50075562-50075584 CGGCCCAGCTCCTTCTTTCAGGG + Intergenic
1167630306 19:50622296-50622318 CGGCCCAGCTCCTTCTTTCAGGG - Exonic
925448040 2:3944374-3944396 CGGAACATCCCCTCCTCTGAGGG - Intergenic
926726211 2:16000199-16000221 CGTGCCAGGCCCTCTTTTGTAGG - Intergenic
927960243 2:27236763-27236785 CGGGCCAGCCCCTCCTTTGAAGG + Exonic
928167530 2:28981791-28981813 CAGGCCAGCCCCTCCTTCCTTGG - Intronic
932819054 2:74884299-74884321 CTGGCAAGACCCTCCTGTGATGG + Intronic
933475096 2:82779485-82779507 CTGGCTAGCCACCCCTTTGAAGG - Intergenic
933811041 2:86032948-86032970 TAGGCCAGCCCCTCATTTTAGGG + Intronic
934298687 2:91763687-91763709 GGGGCCAGGCCCTGCTTTGAGGG - Intergenic
938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG + Intergenic
938692063 2:133800723-133800745 CGTGCCAGCCACACCTTTGTGGG - Intergenic
942946252 2:181678049-181678071 TGCACCAGCCCTTCCTTTGATGG - Exonic
947536544 2:230943368-230943390 CTAGCCAGCCCCTCCGTGGAGGG + Intronic
948176365 2:235946668-235946690 CTGCCCAGCCTCTCCTTGGAGGG - Intronic
948538256 2:238664174-238664196 CTGACCAGCCCCTCTTTTGGGGG + Intergenic
1172091264 20:32434631-32434653 CGGGCCACCCCCCCCTCCGATGG - Exonic
1172845897 20:37929846-37929868 AGGGCCACCCCCTCCTTCCAGGG - Intronic
1174463481 20:50699485-50699507 CGGGCATGGCCCTCCCTTGAGGG - Intergenic
1175591113 20:60192967-60192989 CTGGCCTGGCCATCCTTTGAGGG + Intergenic
1176188153 20:63792925-63792947 TGGGCCATCCCCTCCTTGGATGG + Intronic
1176246452 20:64099498-64099520 TGGGCCAGCCGCACCTCTGAAGG + Exonic
1179625671 21:42648186-42648208 CTGGCCAGCTCCTCGTGTGATGG - Intergenic
1182445307 22:30386536-30386558 AGAGCCAGGCCCTCCTTAGATGG - Intronic
1184162269 22:42703977-42703999 GAGCCCACCCCCTCCTTTGATGG - Intronic
1185325416 22:50223335-50223357 GCGGCCAGCCCCTCCCGTGAGGG + Intronic
949860760 3:8502696-8502718 CGGGCCAGCCCTTCTTGTAAGGG - Intronic
953916218 3:46922670-46922692 CGGCCCAGCCCCTCCACTGTGGG + Intronic
953958065 3:47246746-47246768 TGGGACTGCCCCTCCTGTGAAGG + Intronic
965089686 3:164147125-164147147 CCAGCCAGCCCCTCCTTTTGGGG - Intergenic
968884011 4:3317676-3317698 AGGGCCAGCCTCTCCTGTGGAGG + Exonic
969845014 4:9913715-9913737 AGGGCAAGCCCCTCCTTGGGTGG - Intronic
969872682 4:10114816-10114838 CCGCCCACCCCCTCATTTGAGGG + Intronic
973641076 4:52903365-52903387 AGGGTCAGGGCCTCCTTTGAGGG + Intronic
985564290 5:607616-607638 AGGGCCAGCCGCCCCTTTGCTGG - Intergenic
985571248 5:646699-646721 CGGCCCTGCCCCTCCCATGAGGG - Intronic
985774917 5:1836487-1836509 CGTGCCGGCCCCTCCTCTGCTGG + Intergenic
986345912 5:6835036-6835058 TGTGCCAACCCCTCCTTCGAGGG + Intergenic
990675664 5:58181781-58181803 TGGGTCAGCCCCTCCTTAAAGGG - Intergenic
993306699 5:86283469-86283491 CGGGACACTCCCTGCTTTGAAGG - Intergenic
996655407 5:125928157-125928179 CTGGCCAGCCACCACTTTGAGGG - Intergenic
997199652 5:132002194-132002216 CTGGCCAGGCCCTCCTGTGCAGG + Intronic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1018923176 6:168189733-168189755 TGGGCCAGCACTGCCTTTGAGGG + Intergenic
1021522019 7:21548303-21548325 CTGGCTAGCCACCCCTTTGAGGG + Intronic
1029607739 7:101609254-101609276 AGGGCCAGCCCTGGCTTTGACGG - Intergenic
1033318161 7:140315695-140315717 CGGGCCACCCCCTCCCATCATGG + Intronic
1035924374 8:3711345-3711367 CTGGCCAGCCCTTCCTTGGAGGG - Intronic
1036688938 8:10929074-10929096 CCTGCCTGCCCCTCCTGTGATGG - Intronic
1037911068 8:22743859-22743881 CGGGCCAGCCCCACCCTCCACGG - Intronic
1048549749 8:135423397-135423419 CAGGCAAGCCCCTACTTTTACGG + Intergenic
1053429556 9:38033196-38033218 GGAGCCAGCACCTGCTTTGAGGG - Intronic
1055030636 9:71768957-71768979 GGGGCCACCGCCTCCTCTGATGG - Intronic
1057212446 9:93207482-93207504 CAGGCCAGCCCCTCCTTTTTTGG + Intronic
1057921747 9:99104268-99104290 AGGGGGAACCCCTCCTTTGAGGG + Intronic
1061062734 9:128258656-128258678 TGGGCCAGCCCCTCCCCAGAGGG + Intronic
1062347769 9:136123265-136123287 CGAGCCAACCCCTGCTTGGAAGG + Intergenic
1062398133 9:136360767-136360789 TGGGCCAACCCCTCCTCTTACGG - Intronic
1186788437 X:12974676-12974698 CGGGCCAGGCCCTCCAGGGAGGG + Intergenic
1189536582 X:41941288-41941310 CTGCCCAGATCCTCCTTTGAGGG + Intergenic
1190715443 X:53099077-53099099 TGTGCCAGGCCCTCCTTTAATGG - Intergenic
1190969080 X:55331518-55331540 AGAGCCAGTCCCTCCTCTGATGG + Intergenic