ID: 927962740

View in Genome Browser
Species Human (GRCh38)
Location 2:27250810-27250832
Sequence CTGTGTAAAGAGCTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927962725_927962740 18 Left 927962725 2:27250769-27250791 CCTCTCTGACCCGAAAGCCCACC No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962734_927962740 -9 Left 927962734 2:27250796-27250818 CCCTAGTTAATCAGCTGTGTAAA No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962727_927962740 8 Left 927962727 2:27250779-27250801 CCGAAAGCCCACCCCTCCCCTAG No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962733_927962740 -8 Left 927962733 2:27250795-27250817 CCCCTAGTTAATCAGCTGTGTAA No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962730_927962740 -3 Left 927962730 2:27250790-27250812 CCCCTCCCCTAGTTAATCAGCTG No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962728_927962740 1 Left 927962728 2:27250786-27250808 CCCACCCCTCCCCTAGTTAATCA No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962732_927962740 -5 Left 927962732 2:27250792-27250814 CCTCCCCTAGTTAATCAGCTGTG No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962729_927962740 0 Left 927962729 2:27250787-27250809 CCACCCCTCCCCTAGTTAATCAG No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962735_927962740 -10 Left 927962735 2:27250797-27250819 CCTAGTTAATCAGCTGTGTAAAG No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962726_927962740 9 Left 927962726 2:27250778-27250800 CCCGAAAGCCCACCCCTCCCCTA No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data
927962731_927962740 -4 Left 927962731 2:27250791-27250813 CCCTCCCCTAGTTAATCAGCTGT No data
Right 927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927962740 Original CRISPR CTGTGTAAAGAGCTGGGGCT GGG Intergenic
No off target data available for this crispr