ID: 927964015

View in Genome Browser
Species Human (GRCh38)
Location 2:27258090-27258112
Sequence GACCTGCTTGGGACCCTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927964002_927964015 20 Left 927964002 2:27258047-27258069 CCCCCAGAGTCTCTGCGGGTGGG 0: 1
1: 1
2: 0
3: 12
4: 182
Right 927964015 2:27258090-27258112 GACCTGCTTGGGACCCTGACGGG 0: 1
1: 0
2: 0
3: 5
4: 139
927964008_927964015 17 Left 927964008 2:27258050-27258072 CCAGAGTCTCTGCGGGTGGGGGG 0: 1
1: 0
2: 2
3: 29
4: 233
Right 927964015 2:27258090-27258112 GACCTGCTTGGGACCCTGACGGG 0: 1
1: 0
2: 0
3: 5
4: 139
927964004_927964015 19 Left 927964004 2:27258048-27258070 CCCCAGAGTCTCTGCGGGTGGGG 0: 1
1: 0
2: 5
3: 22
4: 202
Right 927964015 2:27258090-27258112 GACCTGCTTGGGACCCTGACGGG 0: 1
1: 0
2: 0
3: 5
4: 139
927964006_927964015 18 Left 927964006 2:27258049-27258071 CCCAGAGTCTCTGCGGGTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 144
Right 927964015 2:27258090-27258112 GACCTGCTTGGGACCCTGACGGG 0: 1
1: 0
2: 0
3: 5
4: 139
927963998_927964015 26 Left 927963998 2:27258041-27258063 CCAAAGCCCCCAGAGTCTCTGCG 0: 1
1: 0
2: 2
3: 21
4: 846
Right 927964015 2:27258090-27258112 GACCTGCTTGGGACCCTGACGGG 0: 1
1: 0
2: 0
3: 5
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927964015 Original CRISPR GACCTGCTTGGGACCCTGAC GGG Intronic
900126356 1:1070581-1070603 GCCCTGCTAGGGTCCCTGACTGG - Intergenic
900495932 1:2976243-2976265 GCCCTGCTGGGCACCATGACCGG - Intergenic
903135992 1:21309577-21309599 GACCTGCTTGGGACAATGGCAGG - Intronic
905902647 1:41592003-41592025 GACCTGCTTGGGAGCTCTACAGG + Intronic
906654033 1:47534561-47534583 GTCCTGCTTCGGACACTGAAGGG + Intergenic
908520389 1:64935742-64935764 GAACTGCTTGCAACGCTGACGGG + Intronic
910602774 1:89049688-89049710 GACCTGATTGGGAACCTGCGTGG + Intergenic
910637939 1:89429553-89429575 GACCTGATTGGGAACCTGTGTGG - Intergenic
915637183 1:157195268-157195290 GTCCAGCTTGAGACCCTGCCAGG - Intergenic
919881487 1:201904012-201904034 GAGCTGCTTTGGCCCCTGATGGG - Intronic
920538788 1:206761442-206761464 GGCCTCCTTGGCACCCTGGCTGG - Intergenic
1062825672 10:566715-566737 ACCCTGCTTGGGACCCTCAGAGG - Intronic
1063276226 10:4571017-4571039 GACCTGCTGGGGACCTTGGGAGG - Intergenic
1064381754 10:14849032-14849054 GACCTGGTTGGGGCACTAACTGG + Intronic
1068021756 10:51594135-51594157 TACCTCCTTGGGAGGCTGACAGG - Intronic
1074453880 10:113580851-113580873 GACCTGCTTGGCATCCTGGTGGG - Intronic
1075482002 10:122789897-122789919 GACGTACTTGGGACCTGGACTGG - Intergenic
1075739297 10:124684104-124684126 GAGGGGCTGGGGACCCTGACAGG + Intronic
1076516110 10:131045256-131045278 GACATGCTCTGGACCCTGGCAGG - Intergenic
1079109980 11:17599906-17599928 GGCCTGCCTGGGCCCCGGACAGG - Intronic
1081908894 11:46687431-46687453 GAGCTGCTTGGGACAGTGCCAGG + Intronic
1083683882 11:64364651-64364673 GAACTGCTGGGGACCCTCTCAGG - Intronic
1088777093 11:113096046-113096068 GACCTCCTTCAGAGCCTGACAGG - Intronic
1089622569 11:119730020-119730042 GCCCTGCCAGGGACACTGACTGG - Intergenic
1089670316 11:120052370-120052392 GACTTCCTTGGGGCTCTGACGGG - Intergenic
1096069613 12:48767718-48767740 GACCTGATCTGGACCCCGACGGG + Exonic
1096497252 12:52045746-52045768 GACCTGCCTGGGTCCCTGGGAGG + Intronic
1097007467 12:55929527-55929549 GACCTGCCTGGGACCCAACCCGG + Intronic
1101705728 12:107219047-107219069 GACCTGATTGGGAACCTGGGTGG + Intergenic
1104279260 12:127359167-127359189 GACTTGCTTTGGCCCATGACAGG + Intergenic
1104993393 12:132639602-132639624 GACGGGCCGGGGACCCTGACAGG + Intronic
1105542434 13:21326974-21326996 GACCAGCTGGGGATCCTGGCGGG - Intergenic
1105810502 13:23991082-23991104 GCCCTGCCTGGGACTCTGCCAGG - Intronic
1107186424 13:37527222-37527244 GACCGGTTTGGGAAGCTGACAGG - Intergenic
1113054226 13:106250855-106250877 TAGCTGCTTGGGAACCTGAGTGG + Intergenic
1114495838 14:23131557-23131579 GACCTGCTTTTCTCCCTGACAGG - Exonic
1115958430 14:38808606-38808628 GGCCTGCTTGGGAAGCTCACAGG - Intergenic
1117495073 14:56294629-56294651 GCCCTCCCTGGGACCCTGCCTGG + Intronic
1119336422 14:73837270-73837292 CACCTCCTTGGGGCCCTGCCAGG + Intergenic
1119895389 14:78215456-78215478 GCCCTGTTTGGGAGCCTGTCTGG - Intergenic
1121667179 14:95681409-95681431 GACCTGATTGGGAACCTGGGTGG + Intergenic
1122264070 14:100538578-100538600 GGCCTGCTGGGGACCCGGAGAGG + Exonic
1122292391 14:100686825-100686847 AAGCTGCCTGGGACCCTGAAGGG - Intergenic
1122328146 14:100895018-100895040 GACTCGCTTGGTGCCCTGACAGG + Intergenic
1123695272 15:22874468-22874490 GGCCTGGTTGGGAGCCAGACTGG - Intronic
1128666944 15:69545250-69545272 GACCAGGTGGGGACTCTGACTGG + Intergenic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1129708266 15:77806915-77806937 GTCCTGCTTGGAACCCTTCCAGG + Intronic
1132504716 16:302025-302047 GGCCTGCCTGGGAGCCTTACTGG - Intronic
1134291616 16:12906213-12906235 GAGCTGCAAGGGACCCTGAATGG + Intronic
1134432003 16:14218388-14218410 GACCTTGTTTGGATCCTGACAGG - Intronic
1136577527 16:31133312-31133334 GACCTGCCAGGGCCACTGACCGG + Exonic
1139375676 16:66495012-66495034 CACCTGCTTTGCACCCTGAAGGG - Intronic
1143867043 17:9931539-9931561 GAGCTGCTGGGGGCCCCGACAGG + Intronic
1144748645 17:17633337-17633359 GACCTGCCTGGGTCCCTGAAGGG + Intergenic
1146072777 17:29699491-29699513 GACTTGCTTGTGATCCAGACCGG - Intronic
1147621784 17:41872923-41872945 GTCCTGCTTTGGACCCTTCCTGG - Intronic
1147648867 17:42050675-42050697 GCCCTGCCCGGGACCCTGGCCGG - Intronic
1151233769 17:72703502-72703524 GACATGCTTGGAACCCTGTGGGG - Intronic
1151896805 17:76986303-76986325 GCCCTGCTTGGGCCCCACACTGG - Intergenic
1151976074 17:77484119-77484141 AACCTGTTGGGGACCCTGCCCGG - Intronic
1152913132 17:83016809-83016831 AACCTGCATATGACCCTGACAGG + Intronic
1153320034 18:3763773-3763795 GAGCTACTTGGGAGACTGACAGG - Intronic
1154066515 18:11111570-11111592 GCCCTGCCTGGGACCCTGTAGGG + Intronic
1155588148 18:27392259-27392281 GACCTTATTGGGACTCTGAGTGG + Intergenic
1155993128 18:32301667-32301689 GACCTGATTGAGAACCTGAGTGG + Intronic
1160685885 19:436456-436478 GACCTGCCTGGGCCCCCCACCGG + Intronic
1160880026 19:1315543-1315565 GTCCTGCTGGGGACCTGGACAGG - Intergenic
1160901321 19:1430127-1430149 GGCCTGCTAGGGCCCCTGGCAGG + Intronic
1161216924 19:3099259-3099281 GCCCTGCTGGGGACCCAGAAGGG - Intronic
1161965382 19:7544929-7544951 GACCAGCGTGGTACACTGACAGG - Intronic
1162830490 19:13281634-13281656 GAGCTGCTGGGGACACTGTCTGG - Intronic
1163832777 19:19554949-19554971 CACCTACCTGGGACCCTCACAGG - Intergenic
1164399889 19:27895227-27895249 GAAGGGCTTGTGACCCTGACTGG - Intergenic
1166672322 19:44718561-44718583 GACCTGCTCGGGACAGTGAAGGG - Intergenic
1168113810 19:54209639-54209661 GCACTGCTGGGGACCGTGACAGG - Intronic
925996517 2:9298088-9298110 GGGCTGTTTGGGACCCTGCCCGG + Intronic
927964015 2:27258090-27258112 GACCTGCTTGGGACCCTGACGGG + Intronic
928326086 2:30320656-30320678 GACCTGATTGGGAACCTGGGTGG - Intronic
928428835 2:31201388-31201410 CACCTGCTTGGGTCCCTGTGGGG - Intronic
935198140 2:100832677-100832699 GACCTGGATGGGCCCCTGCCTGG + Intronic
936165316 2:110115512-110115534 GACCGGCCTCGGACCCAGACCGG - Intronic
936165346 2:110115617-110115639 GACCGGCCTCGGACCCAGACCGG - Intronic
940603902 2:155895629-155895651 GATCTTCTTGGGATCCTGGCAGG - Intergenic
943180032 2:184529765-184529787 GACCTGCTCCAGTCCCTGACAGG - Intergenic
944994900 2:205282869-205282891 GACCTGATTGGGAACCTGGGTGG - Intronic
946166826 2:217869548-217869570 CACCTGCGTGGGACTCTGAGTGG + Intronic
1172626410 20:36350015-36350037 CACCTGCTTGGGAGCCTGTGGGG - Intronic
1172683123 20:36732571-36732593 GACCTTTTTGAGTCCCTGACAGG + Intronic
1172806486 20:37615524-37615546 GTCCCTCTTGGGACCCAGACAGG - Intergenic
1173557216 20:43974469-43974491 GACCAGCTCGGGACACTGATTGG + Intronic
1175115666 20:56680081-56680103 GACTTGCTTCAGTCCCTGACAGG + Intergenic
1176904277 21:14480814-14480836 GACCTTCTGGGGTCCCTGATGGG - Intergenic
1179180537 21:39041022-39041044 GACCTTATGGGGACCCTGAAAGG - Intergenic
1181108880 22:20590064-20590086 GCAGTGCTGGGGACCCTGACAGG - Intergenic
1183706707 22:39478840-39478862 GCTCTGCTTGGAAGCCTGACGGG - Intronic
952947781 3:38491390-38491412 GACTGACTTGGGACCCTCACTGG - Exonic
954139916 3:48599509-48599531 GAGCTGCTTGGGGCCTTAACTGG + Intronic
955995297 3:64674690-64674712 GACTTGCTTGGGGCCCAGGCAGG + Intronic
961630574 3:128295697-128295719 CACCTGCTTGGGACTCTGGCAGG - Intronic
968508436 4:983282-983304 GACCTGCCTGGGACAATGAGGGG - Intronic
978373555 4:108052147-108052169 GCCCTGAGTGGCACCCTGACAGG - Intronic
979496853 4:121393269-121393291 GACCAGCTGGGTTCCCTGACAGG - Intergenic
980167623 4:129248343-129248365 TTCCTGCCTGGGACCCAGACGGG - Intergenic
985484938 5:143185-143207 CACCTGCTTGGGCACCTGGCTGG - Exonic
986740136 5:10698899-10698921 GACCTGATTGGGAACCTGGGTGG - Intronic
986777201 5:11027052-11027074 GACCTGCTTGTCTCTCTGACGGG - Intronic
995613338 5:113934541-113934563 TACCTCCTTTGGACCCTGAGTGG + Intergenic
997255362 5:132424143-132424165 GACCAGCTTAGGCCCCTGGCTGG - Intronic
999848973 5:155516908-155516930 GACCTGCATGGAACTCTGATGGG + Intergenic
1002564463 5:180101963-180101985 GGACTGCTTGGGACCAGGACAGG - Intronic
1003011545 6:2431910-2431932 GACATGCTCCGGAGCCTGACTGG - Intergenic
1003409586 6:5850847-5850869 GACCAGCTGGGGATCCTGGCGGG + Intergenic
1003872274 6:10412637-10412659 GAGCTGCTTGGGACCGCGTCCGG + Intronic
1004321550 6:14635316-14635338 GTCCTGCCTGGGACACTCACTGG - Intergenic
1006257385 6:32842723-32842745 TACCTGCTTGGCACCATGTCTGG - Exonic
1006279375 6:33036508-33036530 GACCTGATTGGGAACTTGCCCGG - Intergenic
1006332925 6:33405158-33405180 GAGCGGCGTGGGACCCTGAGTGG + Exonic
1008732237 6:54495997-54496019 GACCTGGTTGTGACCCTGCTTGG + Intergenic
1019540764 7:1550058-1550080 GGCCGGCTAGGGCCCCTGACGGG + Intronic
1019970620 7:4537870-4537892 GACCGGCTTGGGTCCCAGGCGGG - Intergenic
1020918249 7:14226113-14226135 TACCTTCTTGGGATTCTGACAGG - Intronic
1023213276 7:37831496-37831518 GACCTGGTTGGGAACCTGGGTGG + Intronic
1024407747 7:49002008-49002030 GACCTGCATGACACCCTGAGAGG + Intergenic
1026081269 7:67223609-67223631 GAGGGGCTTGGCACCCTGACTGG + Intronic
1026695810 7:72590394-72590416 GAGGGGCTTGGCACCCTGACTGG - Intronic
1029578985 7:101422570-101422592 GATCTGTCTGTGACCCTGACAGG + Intronic
1030820227 7:114085120-114085142 GGCCTGCTTGGGACCCAGGGCGG - Intergenic
1032369683 7:131334340-131334362 GCCCTGTTTGGGAACCTTACTGG + Intronic
1035727572 8:1834205-1834227 CACCTGCTTGGGGCCCAGGCGGG + Intronic
1036787849 8:11699643-11699665 AACCTGCTGGGGCCCCTGCCTGG + Intronic
1038882798 8:31633480-31633502 GACCTCCTTGGGACCCTCTTGGG - Intergenic
1042649680 8:71025603-71025625 GACATGCTTGTGACACTGATGGG - Intergenic
1042664944 8:71194451-71194473 GAAGTGCTTGGGACACTGCCTGG - Intergenic
1048537962 8:135315337-135315359 GACCTGGGTGAGACCCTAACTGG + Intergenic
1057217631 9:93238225-93238247 GGCCGGCTTGATACCCTGACAGG - Exonic
1059744229 9:117184470-117184492 GACCTCCTTGGGACACTCTCAGG + Intronic
1060816477 9:126638019-126638041 GACCTGCTTTGGCCCATGGCAGG + Intronic
1061092464 9:128434288-128434310 TTCCTGCTTGGGACCCTGGCCGG + Intronic
1061169042 9:128941423-128941445 GACCTGCTTGTGTCTCTGCCAGG + Exonic
1061368841 9:130186732-130186754 CACCTCCTTGGGACCCTCTCAGG - Intronic
1061904771 9:133690978-133691000 GGCCTGCCTGGGGCCCTGAGAGG - Intronic
1194196021 X:90893765-90893787 GCCTTACTAGGGACCCTGACAGG - Intergenic
1197699385 X:129587054-129587076 GATCTCCTTGGGAACCTGAAGGG - Exonic
1199592267 X:149478106-149478128 GGACAGCTTGGGAACCTGACAGG + Intergenic