ID: 927964223

View in Genome Browser
Species Human (GRCh38)
Location 2:27259122-27259144
Sequence CTCTGTGTATGGAAGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927964223_927964229 15 Left 927964223 2:27259122-27259144 CCCTTTTCCTTCCATACACAGAG 0: 1
1: 0
2: 1
3: 38
4: 391
Right 927964229 2:27259160-27259182 GCTGGAAAGCACCTTACAGACGG 0: 1
1: 0
2: 1
3: 17
4: 166
927964223_927964227 -3 Left 927964223 2:27259122-27259144 CCCTTTTCCTTCCATACACAGAG 0: 1
1: 0
2: 1
3: 38
4: 391
Right 927964227 2:27259142-27259164 GAGCCATAGAATTTCACAGCTGG 0: 1
1: 0
2: 3
3: 28
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927964223 Original CRISPR CTCTGTGTATGGAAGGAAAA GGG (reversed) Intronic
901423889 1:9168969-9168991 CCCTGTGGATGGAAGGAAGTAGG - Intergenic
902739391 1:18424524-18424546 AGCTGTCCATGGAAGGAAAAAGG - Intergenic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904221430 1:28973196-28973218 CTCTGACTAGGGAAGTAAAAGGG + Intronic
904336284 1:29800437-29800459 GTCTGGGTGTGGAAGGAGAAGGG - Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
906905529 1:49886697-49886719 CAGTCTGTATGGAAGGAGAATGG - Intronic
907267080 1:53269011-53269033 CTCTGAGTAGGGAAGGGACATGG - Intronic
907626224 1:56032700-56032722 CTCTGGGTCTGGGAGGATAATGG + Intergenic
908925011 1:69243512-69243534 CTCGATGTATGTAAGCAAAATGG - Intergenic
910450834 1:87343009-87343031 TTCTGCGAATAGAAGGAAAATGG - Intronic
916498161 1:165364098-165364120 CTCTGTGCACAGAAGGAAATGGG + Intergenic
916803211 1:168233481-168233503 CTCTGTGTCTGGCTGGAAATGGG + Intronic
917465928 1:175276097-175276119 CTCTCTGTATGAGAGGAAAGGGG - Intergenic
918412793 1:184277673-184277695 CTCTGTGTGTGGAAGGGGACAGG + Intergenic
918428272 1:184432840-184432862 CTGTCTTTATTGAAGGAAAAGGG + Intronic
919128751 1:193428146-193428168 CACCTTGGATGGAAGGAAAAAGG + Intergenic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
920056225 1:203194240-203194262 TTTAGTATATGGAAGGAAAACGG + Intergenic
920442687 1:205991604-205991626 GTGTGTTTATGGAAGGAGAAAGG - Intronic
920795231 1:209130593-209130615 GTGTGTGTATGAAAGGAAAAGGG - Intergenic
921293373 1:213679274-213679296 CTGTGAGTATGGAAGGACATAGG - Intergenic
921579119 1:216874534-216874556 GCCTCTGTATGGAAGGAAGAAGG - Intronic
921673133 1:217948677-217948699 ATGTGTGTATGAAAGGAAAGGGG - Intergenic
922304711 1:224334277-224334299 CTCTATGTATAGTAGGAACATGG + Intergenic
922412705 1:225391600-225391622 CTCCGTGTTTGGAAGGACAGGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924081895 1:240406811-240406833 ATCAATGTAAGGAAGGAAAATGG + Intronic
924703156 1:246474710-246474732 CAAGGTTTATGGAAGGAAAAGGG + Intronic
1063212032 10:3889319-3889341 CTCTGGGTACAGAAGTAAAAAGG - Intergenic
1063392095 10:5656603-5656625 CTCTGTGTAAGAATGGATAAAGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064144786 10:12819074-12819096 CTCTGTAGAAGGCAGGAAAAAGG + Intronic
1064158692 10:12925041-12925063 CTCTGTGTGTTGAAGGAGAGGGG + Intronic
1064711503 10:18130887-18130909 ATCTGTGTTTGGGAGGAAAATGG + Intergenic
1065345841 10:24747413-24747435 CTCTGAGGGGGGAAGGAAAAGGG + Intergenic
1065719934 10:28617530-28617552 TTTTGTGTATTGAAGGGAAAAGG + Intronic
1066598563 10:37078959-37078981 CTCTGTGTCTACAATGAAAATGG - Intergenic
1067925775 10:50506726-50506748 CTCTGTGACAGGAAGTAAAAAGG + Intronic
1068619685 10:59167705-59167727 AACTGGGTATGGAAAGAAAATGG - Intergenic
1070868841 10:79729968-79729990 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071635756 10:87252187-87252209 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071659487 10:87485789-87485811 CTCTGTGGCTGGAATGGAAATGG - Intergenic
1071767870 10:88689388-88689410 CTCTGTTTATGGAAGGGTGAAGG + Intergenic
1073734838 10:106334111-106334133 CTCTGTGTTTAAGAGGAAAAAGG - Intergenic
1074538385 10:114345190-114345212 CTCTGTGTATCGGGGGAACATGG + Intronic
1075284141 10:121168376-121168398 CTCTTTTTATGGAAGCAAAAAGG + Intergenic
1075298122 10:121296020-121296042 CTTTGTGAATGGATAGAAAATGG + Intergenic
1075780980 10:125016954-125016976 CACTGTGGATGGAAGGGGAATGG + Intronic
1076213500 10:128673365-128673387 CTCTGGGGATAGATGGAAAAAGG - Intergenic
1076328633 10:129647959-129647981 CTATATTTATGGAATGAAAAGGG - Intronic
1077601892 11:3580354-3580376 CTCTCTGTAGGGATGGAAAGAGG + Intergenic
1077734600 11:4776101-4776123 CTCTGTGTTTTGAAGCAAAATGG - Intronic
1077745838 11:4904088-4904110 CTTGATGTCTGGAAGGAAAATGG + Intronic
1078147512 11:8731675-8731697 CTCTGTGTATGGTAAAAAGAGGG + Intronic
1078184100 11:9036979-9037001 CTTTCTCTCTGGAAGGAAAATGG - Intronic
1078389803 11:10927196-10927218 CTTTGTATATGGAAGCAAACAGG - Intergenic
1078406418 11:11074039-11074061 CTCTGAGAGTGAAAGGAAAATGG + Intergenic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080377456 11:31730136-31730158 CTCGGAGTATGCAAGGACAATGG - Intronic
1080905655 11:36542394-36542416 CTTTGTGTGTAGAAGGAAAGAGG - Intronic
1081546591 11:44076137-44076159 CTCTTAGCATGGAAGGAAATTGG + Intronic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1083225661 11:61282898-61282920 GTCAGTGTCTGGCAGGAAAAGGG + Exonic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1084257806 11:67954900-67954922 CTCTCTGTAGGGATGGAAAGAGG + Intergenic
1084456031 11:69268768-69268790 CTGTGTGGTGGGAAGGAAAATGG + Intergenic
1084814958 11:71640337-71640359 CTCTCTGTAGGGATGGAAAGAGG - Intergenic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1088173705 11:107025717-107025739 CTCTTTGTTTGGAAAGAACAGGG + Intergenic
1088229710 11:107661264-107661286 TTGTGTGTAAGGTAGGAAAATGG + Intronic
1088720466 11:112587822-112587844 TTCTGGGTAGGGAAGAAAAAAGG - Intergenic
1090278032 11:125433072-125433094 CTCTATGTATGGCATCAAAAGGG - Exonic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091159429 11:133406352-133406374 CTTTCTGCATGGAAGGAGAATGG - Intronic
1091263293 11:134251015-134251037 ATCTTTGAAGGGAAGGAAAAAGG - Intronic
1091415142 12:276368-276390 TGCTGTGTATGGAGGGATAAAGG + Intergenic
1092317390 12:7432344-7432366 CAGTATGTATGGAAAGAAAAAGG - Intronic
1092428037 12:8389697-8389719 CTCTCTGTAGGGATGGAAAGAGG + Intergenic
1092552270 12:9515661-9515683 CTCTGTGTCTGCAATGAAGAAGG - Intergenic
1093138466 12:15479207-15479229 CTCTTTCTAAGGAAGCAAAAAGG - Intronic
1093553063 12:20437949-20437971 CTCTTTTTATGTAAAGAAAAAGG + Intronic
1094045360 12:26160637-26160659 CTATGAGTAAGGAAGAAAAATGG - Intronic
1094830140 12:34296407-34296429 CGCTGTGGAAGGAAGAAAAACGG + Intergenic
1095660912 12:44734945-44734967 CTCAATATATGGAAGGAAAATGG - Intronic
1096000623 12:48126895-48126917 CTATGTGTGTGAAAGGAACAAGG - Intronic
1097468450 12:59957378-59957400 TTGTGTGTCTGGAAGTAAAATGG + Intergenic
1098587226 12:72168397-72168419 CTCTGTTTATATAAGCAAAATGG - Intronic
1100289788 12:93202775-93202797 ATCTGTGGAAGGAAGGAAGAAGG + Intergenic
1100555663 12:95691217-95691239 CTTCTTGTTTGGAAGGAAAAAGG + Intronic
1100833499 12:98541772-98541794 ATCTGTAGATGGAAGGGAAAAGG - Intronic
1102477216 12:113196447-113196469 ATCAGTGGAAGGAAGGAAAACGG - Intronic
1102906330 12:116678271-116678293 TTATATGTATGGAAAGAAAAAGG - Intergenic
1103432301 12:120899125-120899147 CTCAGTGTATGTGAGAAAAAAGG + Intronic
1103563832 12:121805592-121805614 CTCTGGGTTCGGAAGGAAAGGGG - Intronic
1104731225 12:131106519-131106541 CTCCATGTGTGGGAGGAAAAAGG + Intronic
1104838255 12:131806561-131806583 CTCACAGAATGGAAGGAAAACGG + Intergenic
1105374745 13:19833309-19833331 TTTTGTGTATGCAATGAAAAGGG + Intronic
1105724702 13:23150704-23150726 TTTTGTGTATGGTAGGAAGAAGG + Intergenic
1106676795 13:31968387-31968409 ATCTGTGTATAGAGGGAAACTGG - Intergenic
1107057625 13:36124338-36124360 CCCTCTGAATAGAAGGAAAAAGG + Intronic
1107560657 13:41554281-41554303 TTCTGAGAATGAAAGGAAAAAGG - Intergenic
1108510728 13:51153281-51153303 CTCTGAGGAGGGCAGGAAAAGGG - Intergenic
1109020538 13:57085327-57085349 TTGTGTGTATGAAAGGAAAGAGG + Intergenic
1109567124 13:64131884-64131906 CTCTGCCTATGGAAAGGAAAGGG + Intergenic
1109588230 13:64438662-64438684 ATATGTGTAAAGAAGGAAAAAGG - Intergenic
1109947698 13:69459442-69459464 CACAGAGTATTGAAGGAAAAAGG + Intergenic
1110249645 13:73367014-73367036 CTCTGGGAATGGAAGGTTAAGGG + Intergenic
1110315840 13:74105386-74105408 ATCTGTATAGTGAAGGAAAATGG + Intronic
1111486442 13:88907020-88907042 CTCTGTGTTAGGAAAGAACATGG + Intergenic
1112032051 13:95465774-95465796 CTCTGAGTATCGAAGGTGAATGG - Intronic
1112043409 13:95571238-95571260 CACAGTGCATGGAAGGATAATGG + Intronic
1112074791 13:95900239-95900261 ATCTATGTATGGTAGAAAAAAGG + Intronic
1112265093 13:97916314-97916336 TTATGTGTATGGAGGGAAATGGG + Intergenic
1112641901 13:101284933-101284955 ATGTGTGTATGGTAGGAATAGGG + Intronic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1117000520 14:51366422-51366444 CCCTGTGCATGGAAGGAAAAAGG + Intergenic
1117078654 14:52129068-52129090 AGCTGTGTATAGAATGAAAAAGG - Intergenic
1117870373 14:60194464-60194486 CTCTGAGGAGGGAAGGAAAGAGG + Intergenic
1118495711 14:66306335-66306357 CTCTGTGTAGGAAGGGACAAGGG + Intergenic
1119383774 14:74244662-74244684 CTCTGTGCTTGGGAGGAAGAGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120961025 14:90125061-90125083 TACTGTAGATGGAAGGAAAAGGG + Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121759712 14:96434828-96434850 CTCTGTCTTTGGAAAGAAGAGGG - Intronic
1122046825 14:99029880-99029902 CACTGTGTGTGGAAGGAGAAGGG + Intergenic
1122898161 14:104770692-104770714 CTCTGAGTGTGGAGAGAAAAGGG + Intronic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1125210130 15:37204940-37204962 TACTGTGGATAGAAGGAAAATGG + Intergenic
1126386743 15:48100999-48101021 CTTTGTTTATGGAAGAAAAAAGG - Intergenic
1126951553 15:53887169-53887191 GTTTGTGTGTGGAAGGAGAAGGG + Intergenic
1127126388 15:55816565-55816587 CTCTGTGTATGAGAGTAGAAAGG - Intergenic
1127131341 15:55867742-55867764 CTCTGTGATTTGAAGAAAAAAGG + Intronic
1128411235 15:67400441-67400463 CATTGTGTATATAAGGAAAAAGG - Intronic
1128511199 15:68314945-68314967 CTCTGTGTGGGGAAGGACAGAGG - Intronic
1128665392 15:69533782-69533804 ATTTAAGTATGGAAGGAAAAGGG - Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1130745026 15:86643075-86643097 CTCACTGCATGGAAGCAAAATGG + Intronic
1131895114 15:97019710-97019732 CCCTTAGTATGGAAGGAAGAAGG + Intergenic
1132683105 16:1151957-1151979 CTCTTTGTCTGGAGGGAGAAGGG + Intergenic
1133370201 16:5240670-5240692 CTCTCTGTAGGGATGGAAAGAGG - Intergenic
1135194618 16:20384288-20384310 CTCTGTTTTTAGAAAGAAAACGG - Intronic
1135327956 16:21539387-21539409 GTCTCTGTCTGGAAGGAAGATGG + Intergenic
1135527480 16:23225112-23225134 AAATGTGAATGGAAGGAAAATGG - Intergenic
1137601767 16:49761092-49761114 CACTGTGTTTGGGAGGCAAAGGG - Intronic
1137852838 16:51763372-51763394 CTTTGTGTATGGAAGGGACTAGG + Intergenic
1138753873 16:59458444-59458466 CTTTTGGAATGGAAGGAAAAAGG - Intergenic
1139207619 16:65044541-65044563 CTCTCTATACAGAAGGAAAAAGG + Intronic
1140722892 16:77787346-77787368 CCCTGTGGAAGGAGGGAAAATGG + Intergenic
1141288813 16:82698354-82698376 CTCTGTAGATGGTGGGAAAAAGG + Intronic
1141783973 16:86185925-86185947 CTTTGAGTAGGGAAGGACAAGGG + Intergenic
1142324303 16:89404308-89404330 ATCTGTGTAACTAAGGAAAATGG + Intronic
1143846717 17:9777720-9777742 CTCCTAGTATGGAAGGAAGAAGG + Intronic
1146427994 17:32762206-32762228 CCCTGTGACTGGAAGGAGAAAGG + Intronic
1147027759 17:37603099-37603121 CTCTGAGCCTGGAAAGAAAAAGG + Intronic
1147056913 17:37841837-37841859 CTCAGTGCATGGGAGGAAGAAGG - Intergenic
1147163189 17:38579437-38579459 CTCTGGGGAGGGAAGGGAAAAGG - Intronic
1148552435 17:48558537-48558559 CTCTGAGAATGGAAGAAAAAAGG - Intronic
1149256296 17:54831178-54831200 CCCTGTGTAGAGAAGGGAAAAGG - Intergenic
1149349335 17:55771524-55771546 CTCAGTCTACAGAAGGAAAAAGG + Intronic
1149423700 17:56534610-56534632 CCCTGTCTTTGGAGGGAAAATGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152167887 17:78722786-78722808 CTATGTGTATTGATGGAAAGAGG + Intronic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1153398681 18:4656049-4656071 CTCTGTGCAGGAAAGAAAAATGG - Intergenic
1153668109 18:7384408-7384430 CTCTGTGTTTGGAAAACAAAAGG - Intergenic
1155277332 18:24201111-24201133 CTCTCTGTATGAAGAGAAAAAGG - Intronic
1155876214 18:31091945-31091967 CACAGTGTTTAGAAGGAAAAGGG - Intronic
1156287354 18:35710879-35710901 ATCTGAGTATGGAGTGAAAAAGG - Exonic
1156795875 18:41045582-41045604 CTGTGTGTCTGGAAGCAGAATGG - Intergenic
1156852835 18:41747937-41747959 CACAGTGTCTGGAAGGAAAAAGG + Intergenic
1159213074 18:65354310-65354332 CTCTGTGTATAGCAAGAAATGGG + Intergenic
1159758272 18:72392657-72392679 CTCTTTCTATGTAAGGAGAATGG - Intergenic
1162876153 19:13622474-13622496 CTCTGTGTCTTGGAGGAAAATGG + Intronic
1164048858 19:21566873-21566895 CTCTGCCTAGGGAAGGTAAAAGG + Intergenic
1164300895 19:23962225-23962247 CTTTGTGTATGGAAGAGGAATGG - Intergenic
1164962823 19:32450487-32450509 CACTGTTTATGGAAGGGATATGG - Intronic
1165785669 19:38460354-38460376 CCCTGGGTAAGGAAGGACAATGG - Exonic
1166546076 19:43635560-43635582 TCCTGTGTCCGGAAGGAAAAGGG - Intronic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
926674585 2:15610433-15610455 TTCTGTGTATGGCATGAGAAAGG + Intronic
927211964 2:20644615-20644637 CACTTGGTATGGAAGGGAAAGGG - Intronic
927921705 2:26977615-26977637 CTCTATCCCTGGAAGGAAAAAGG - Intronic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
929095191 2:38256978-38257000 CTCATTTTATGGAAGGTAAAAGG + Intergenic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
936283523 2:111163005-111163027 ATCTTGTTATGGAAGGAAAAGGG + Intronic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
938710399 2:133971556-133971578 CACTTTGTATGGGTGGAAAAAGG + Intergenic
938749244 2:134312994-134313016 CTCAGAGCAAGGAAGGAAAAAGG - Intronic
939203456 2:139069238-139069260 CATTGTCTATGCAAGGAAAATGG - Intergenic
940235260 2:151504722-151504744 ATCTGCGTATGGATGGGAAAAGG + Intronic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
941012977 2:160322304-160322326 CTCTGAGTATGGAAGAAGAAGGG + Intronic
942627454 2:177917140-177917162 CTCTTTCTTTGGAAGGACAAGGG - Intronic
943344057 2:186716367-186716389 TTCTGGGTAAGGAAGGAAAAGGG - Intronic
944916689 2:204368283-204368305 CTCTGTACACGGAAGGGAAACGG - Intergenic
946673586 2:222132933-222132955 CTCTGTGAATGGAAAGAAAGGGG + Intergenic
946748107 2:222865659-222865681 CACAGAGTAGGGAAGGAAAAGGG + Intronic
947345083 2:229182298-229182320 CTGTGTGTTTTGAAGGAAAGAGG + Intronic
947675342 2:231974067-231974089 CTTTGCATATGAAAGGAAAAAGG - Intronic
1169652291 20:7882732-7882754 AACTGTGGAAGGAAGGAAAAGGG + Intergenic
1170555711 20:17513228-17513250 CTCTGAGAAGGGGAGGAAAAGGG - Intronic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171258672 20:23711396-23711418 CTCTGTGAAAGGAAAGAGAACGG + Intergenic
1173287495 20:41686560-41686582 CTTTGTGTGTGGAAGTCAAATGG - Intergenic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174285222 20:49468078-49468100 CTCTGTAAATGGAAGGCAAAAGG + Intronic
1174672737 20:52323180-52323202 CTCTTTGAATGGCAGAAAAAGGG - Intergenic
1175247444 20:57590415-57590437 CTCTGGCTCTGGAAGGAACATGG - Intergenic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1176993143 21:15522298-15522320 CTCTGTGGATGGCAGGTTAATGG - Intergenic
1177051601 21:16241827-16241849 CTCACTGTAGGGAAGAAAAAGGG - Intergenic
1177770582 21:25510965-25510987 ATCTGTTTATTGAAGGAACAAGG + Intergenic
1177844434 21:26272105-26272127 CTCCATGTCTGAAAGGAAAAGGG + Intergenic
1178919255 21:36728063-36728085 CCCTCTGCATGGCAGGAAAATGG - Intronic
1180025848 21:45161622-45161644 CACTGTGGATGGCAGGATAATGG + Intronic
1181087158 22:20446255-20446277 ATATGTGTATGGGGGGAAAAGGG + Intronic
1181182124 22:21075699-21075721 ATTTGTGTTAGGAAGGAAAACGG + Intergenic
1181462785 22:23095232-23095254 CTCTGTGTTTGGCAGGTGAAGGG + Exonic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1182558285 22:31140722-31140744 CTCCTTGAAGGGAAGGAAAAGGG + Intergenic
1182608577 22:31527352-31527374 CTGTGTGTGTGTAAAGAAAAAGG + Intronic
1185014449 22:48334955-48334977 CTCTGTGAACTGAAGGAAAGAGG + Intergenic
949198659 3:1344380-1344402 GTCTGTGGAAGGAAAGAAAAAGG + Intronic
949305622 3:2637243-2637265 CCTTGTGTATGTAAAGAAAATGG - Intronic
950943459 3:16918667-16918689 CTTTATGTGTTGAAGGAAAAAGG + Intronic
951154915 3:19339948-19339970 TTCTGTGTGTGGAAAGAAGAGGG + Intronic
951447436 3:22798960-22798982 CTCTGTGTCTGGAGGCAAAGTGG - Intergenic
953778870 3:45847700-45847722 CTCTGAGCCTTGAAGGAAAAAGG - Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954884111 3:53857030-53857052 CTTAGTGTGTTGAAGGAAAATGG + Intronic
955333734 3:58068409-58068431 CTGTGTGGATGGAAGGGATATGG + Intronic
955510015 3:59670256-59670278 CTCAATGTATGGAAGAAGAAAGG - Intergenic
956050422 3:65242037-65242059 CTCTGTTCATGGATGTAAAATGG + Intergenic
956166773 3:66403393-66403415 CTCTGTGTATGTTTGAAAAAGGG - Intronic
956172452 3:66443500-66443522 CTCTGTGTAGGGGAAGAGAAAGG + Intronic
956662827 3:71616162-71616184 GTCTGTGTGTGGCTGGAAAAGGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956767611 3:72497107-72497129 CTCAGTGTCAAGAAGGAAAAAGG - Intergenic
957072735 3:75579388-75579410 CTCTCTGTAGGGATGGAAAGAGG + Intergenic
958150425 3:89686106-89686128 AAATGTGCATGGAAGGAAAATGG - Intergenic
958189573 3:90167570-90167592 CACTGAGTTTGGGAGGAAAATGG + Intergenic
959459965 3:106613695-106613717 CTATCTGCCTGGAAGGAAAATGG + Intergenic
959681722 3:109104221-109104243 CTCTCTGTGGGGAGGGAAAAAGG + Intronic
961211763 3:125131042-125131064 ATTTGTGTGTGGAAGGAAAGAGG + Intronic
961281335 3:125767363-125767385 CTCTCTGTAGGGATGGAAAGAGG - Intergenic
961418985 3:126784695-126784717 CTCAGTTCATGGAAGAAAAAAGG + Intronic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964158859 3:153621519-153621541 CTGTGTGTGTGGAAGAGAAAGGG + Intergenic
964198048 3:154087384-154087406 CTAGGTGTATGGAAGGATGATGG - Intergenic
965537584 3:169839704-169839726 CTCTGTCTATGAAACAAAAATGG - Exonic
965768106 3:172152985-172153007 GTATGTGTTTAGAAGGAAAAAGG + Intronic
966953419 3:184846657-184846679 CTCTGTGCCTGGAAGGCAAGCGG + Intronic
967856217 3:194119440-194119462 CTCTGTGTAGGCAAGGATAGAGG - Intergenic
968140813 3:196254896-196254918 CTCAGAGAAAGGAAGGAAAAGGG - Intronic
969737614 4:9001626-9001648 CTCTCTGTAGGGATGGAAAGAGG - Intergenic
969796812 4:9533187-9533209 CTCTCTGTAGGGATGGAAAGAGG - Intergenic
969810593 4:9644597-9644619 ATTTGGGTAGGGAAGGAAAAAGG - Intergenic
970249114 4:14095155-14095177 CTCTGTGTAAGGAGAAAAAAAGG - Intergenic
970581318 4:17476746-17476768 CTCTGTCCATGGGAGGAAACTGG - Intronic
971388660 4:26165078-26165100 GTTTGTCTATGGAATGAAAAGGG + Intronic
971780782 4:31031724-31031746 CTCAGTGTAAGGAATTAAAAGGG + Intronic
973029939 4:45324997-45325019 CACTCAGGATGGAAGGAAAAGGG - Intergenic
973538845 4:51913860-51913882 ATATGTGTATAAAAGGAAAAAGG + Exonic
973966597 4:56169412-56169434 CTCTGGGCATGGGAGGTAAACGG - Intergenic
975258410 4:72267796-72267818 CTCTAGGTCTGGAAGGAATATGG + Intergenic
976517139 4:85981961-85981983 CTCTGTAGAGGGAAGGAAAGAGG - Intronic
976813990 4:89125343-89125365 CTCTGTGTTGGGAGGGAGAAAGG + Intergenic
977423603 4:96836197-96836219 CTCGCTGTAAGGAAGGAAACTGG + Intergenic
977750254 4:100601343-100601365 CTCCATGTATGTAAGGAATATGG - Intronic
978109093 4:104940843-104940865 CTCTTTGTAAGGAAACAAAATGG - Intergenic
978225937 4:106335087-106335109 CTCTGTTGATGGGAGGAAGATGG + Intronic
979404275 4:120289795-120289817 CTTTGTGTTTTGAAGGACAAAGG + Intergenic
980113899 4:128660949-128660971 CTCTGTCTATATAAGAAAAAAGG - Intergenic
982844752 4:160236145-160236167 CCCTGTGAATGGAAGGTAACTGG + Intergenic
983142693 4:164172496-164172518 CTCTGTGTATGTAACTAAGAAGG - Intronic
983388971 4:167103498-167103520 CTCTGTCCATGGAAGGGACAGGG + Intronic
984771819 4:183443400-183443422 CTTTTGGTATGGCAGGAAAATGG + Intergenic
984877018 4:184378337-184378359 ATGTGTGTCTGGAAAGAAAATGG - Intergenic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985535190 5:460691-460713 CTCTGTGGATAGAAGGCCAATGG - Intronic
985804595 5:2032942-2032964 TTCTGTGAAAGGAAGAAAAATGG - Intergenic
986223687 5:5793437-5793459 CTCTCTGTGTGGGAGGAAATGGG - Intergenic
987425528 5:17768486-17768508 ATCTGTCTATGGAAGCAAAAGGG - Intergenic
987527338 5:19069824-19069846 CTCTGTGTGTGGTAGGATGAAGG + Intergenic
987876169 5:23684447-23684469 CTCTGACAAGGGAAGGAAAAGGG + Intergenic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
990042920 5:51394422-51394444 CTCTCTCTATGGAAATAAAAAGG + Exonic
990630329 5:57661812-57661834 CTCTGAGTCAGGAAGGCAAAGGG + Intergenic
990741304 5:58915392-58915414 CTCAGTGTGTGAAAGGAAATAGG + Intergenic
991312651 5:65261628-65261650 CTCTAAGTAAGGAAGGGAAATGG + Intronic
991557730 5:67914405-67914427 CTCTGTGTGTTGAAGTAGAAGGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992563519 5:77975203-77975225 CTCTGTGTGTGGTAGCAGAAAGG - Intergenic
993311722 5:86340522-86340544 ATCTGTATATGGTAGGAGAAAGG - Intergenic
994077581 5:95670612-95670634 CTTTGTGTGGGGAAGTAAAAGGG - Intronic
994459898 5:100059345-100059367 CTCTGTGTAAGAAAACAAAAAGG - Intergenic
994544276 5:101143387-101143409 CTCTGTGTGTGGAAGATAACAGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996600511 5:125257550-125257572 CTGTGTGTATAGCAGGGAAAGGG - Intergenic
998884021 5:146675474-146675496 CCCAGTGAATGAAAGGAAAATGG + Intronic
998913718 5:146992437-146992459 CTCTTTGTATGGAAGGAGTATGG + Intronic
998959896 5:147474230-147474252 TTATGTGTATGGGAGGACAAAGG - Intronic
999378515 5:151103783-151103805 CCCTGTTTTTGGAAGGAACAAGG - Intronic
999874502 5:155787529-155787551 CTCTGCGAATGGAAGGAATGTGG + Intergenic
1001093399 5:168758009-168758031 CTCCCGGTGTGGAAGGAAAATGG - Intronic
1001433574 5:171682392-171682414 CTTGGTTTAAGGAAGGAAAAAGG + Intergenic
1001828460 5:174765405-174765427 CTCTATTTTTGGAAGGAAATTGG + Intergenic
1001846715 5:174928604-174928626 CTCTCTGTATAGAATGAACAAGG + Intergenic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1003822717 6:9917920-9917942 CTGAGAGTAGGGAAGGAAAATGG - Intronic
1004571615 6:16851265-16851287 CACTGTGTATGCATGGAAGAGGG + Intergenic
1005098331 6:22142886-22142908 CTCTGGCTCTGGAAGTAAAAAGG - Intergenic
1005361935 6:25039030-25039052 CTCTGTGTATTTAAAGAAAAGGG + Intronic
1005568965 6:27126217-27126239 CTCTTTGTAAGGAAGGATATTGG - Exonic
1006001621 6:30969579-30969601 CACTTTGCATGGAAGGAGAACGG + Intergenic
1007289139 6:40771819-40771841 CTCTGTATCATGAAGGAAAAAGG - Intergenic
1008849318 6:56005616-56005638 CTCAGTGGATGGTAGGAAAAAGG - Intergenic
1009675490 6:66814213-66814235 ATATGTGTTTTGAAGGAAAAAGG + Intergenic
1010391888 6:75347098-75347120 CTCTGTGCATTGAAGAAATAAGG + Intronic
1012448621 6:99331730-99331752 CTCTGTCGAGGGAAGGAACATGG + Intronic
1012603331 6:101126181-101126203 CTCTGTGAATAGAAGAAAGAAGG - Intergenic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1012871927 6:104682997-104683019 CTCGGCGGATGGCAGGAAAAGGG + Intergenic
1013438624 6:110139037-110139059 CTATGAGCATGGGAGGAAAATGG - Intronic
1014125205 6:117769278-117769300 GTGTGTGTATGCAAGGAATAGGG - Intergenic
1014808998 6:125864413-125864435 CTCTCTGATTGGAGGGAAAATGG + Intronic
1015248836 6:131105401-131105423 GTCTGTTAAGGGAAGGAAAAGGG + Intergenic
1016508668 6:144814665-144814687 CTTTATGAATGGGAGGAAAATGG + Intronic
1016826819 6:148396077-148396099 CTTTGTGAATACAAGGAAAAGGG + Intronic
1017242218 6:152183198-152183220 CTCTGTGAATGAAAGGGAAAAGG - Intronic
1017398118 6:154027714-154027736 CTCTGCCTTTGGAAAGAAAAAGG - Intronic
1018433943 6:163744535-163744557 CGGTGTGTAAGGAAGGAACATGG + Intergenic
1020711197 7:11607770-11607792 CTCTGTTTTTACAAGGAAAATGG - Intronic
1023121904 7:36918086-36918108 CTCTGAGGAGGGAAGGAAATGGG + Intronic
1024115327 7:46187445-46187467 CTCTCTGGATGCAAGTAAAATGG + Intergenic
1024245272 7:47464991-47465013 TTTTGTGCATGGAAGGAAATAGG - Intronic
1026366084 7:69649958-69649980 GACTGTGTGGGGAAGGAAAAGGG - Intronic
1026458635 7:70594565-70594587 CTCTGTGTATTCAAGGACCAGGG + Intronic
1027232233 7:76279551-76279573 CTCTGTGTAGGGAGGGAGACAGG + Intronic
1028577627 7:92369887-92369909 CTCTGTCCATGGAAGGGAGAGGG + Intronic
1028674223 7:93440393-93440415 ATCTTTGGATGGGAGGAAAATGG - Intronic
1028775153 7:94667286-94667308 CTCTGTGTGTGGCAGCAAAATGG - Exonic
1029022534 7:97380271-97380293 TTCTGTCTAGGAAAGGAAAATGG - Intergenic
1030433742 7:109488052-109488074 CTCTGTGCATGGAAAGCACAGGG + Intergenic
1030816312 7:114041701-114041723 CTCTGTATCTGGATGGAGAATGG + Intronic
1032914816 7:136478028-136478050 CTCTGTTTGTGTAAGGCAAATGG + Intergenic
1033053567 7:138029076-138029098 AACTGTCCATGGAAGGAAAAAGG + Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1035162259 7:156959781-156959803 TTCTGTGTGTTGAAGGAGAAAGG + Intronic
1036258096 8:7221141-7221163 CTCTCTGTAGGGATGGAAAGAGG + Intergenic
1036359390 8:8066365-8066387 CTCTCTGTAGGGATGGAAAGAGG - Intergenic
1036827774 8:11991754-11991776 CTATCTGTATGGAAACAAAATGG - Intergenic
1036830023 8:12014258-12014280 CTCTCTGTAGGGATGGAAAGAGG + Intronic
1036891566 8:12600587-12600609 CTCTCTGTAGGGATGGAAAGAGG + Intergenic
1037150593 8:15630851-15630873 CTCTCTGTAAGGAAACAAAAGGG - Intronic
1037581263 8:20247209-20247231 CTCTGTGTATGGAAGGTACCGGG + Exonic
1037824728 8:22154541-22154563 ATCTGTGTGTGGGAGGGAAAGGG - Exonic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038379709 8:27081122-27081144 ATGTGTATATGGAAGGGAAAAGG + Intergenic
1038843809 8:31210521-31210543 CCCTGTGAAAGGAAGGAGAAGGG - Intergenic
1039362905 8:36899596-36899618 CTCTGTGTATGCAAAGAATCAGG + Intronic
1040879008 8:52183974-52183996 CTTTGTGTGTGCATGGAAAATGG + Intronic
1040983712 8:53270841-53270863 CCCGGTTTATTGAAGGAAAAAGG - Intergenic
1042612334 8:70613037-70613059 CCCTGTGAAAGGAAGGAAGAAGG + Intronic
1042989808 8:74626441-74626463 CTCTGTGGATGGAAGTAAGAGGG + Intronic
1043220747 8:77660458-77660480 CTCTGATAATAGAAGGAAAATGG - Intergenic
1043436517 8:80240690-80240712 CTCTGTGGCTGGAACCAAAAGGG - Intergenic
1043613983 8:82102983-82103005 TTCTGTTTTTGGAAGGAAAATGG + Intergenic
1043817448 8:84819064-84819086 CTCTATGTCTGCAGGGAAAAAGG + Intronic
1044535521 8:93352937-93352959 CTCTGGGGATGGACGGCAAAGGG - Intergenic
1044875853 8:96665782-96665804 CTCAGTATATGGTAGGCAAATGG + Intronic
1045192952 8:99901144-99901166 CTGTGTGTCTGAAAGGAGAATGG - Intergenic
1045874173 8:106959778-106959800 TTCTGTATATGGAATGAGAAAGG - Intergenic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1047184930 8:122624344-122624366 CTCTTTGCATGGCAGGAAAATGG - Intergenic
1047228649 8:122977393-122977415 CTCTGTATCTGAAAGGAAGAAGG + Intergenic
1047912380 8:129544403-129544425 TTCTGTTTTTGGAATGAAAAAGG - Intergenic
1047937931 8:129800106-129800128 CTCTGTCTATGGAAAGAGAAGGG - Intergenic
1048044692 8:130762334-130762356 TTCTTTGTTTGGAAGGAAAGAGG - Intergenic
1048460107 8:134614473-134614495 CTGTGTGTGTGTAAGGAGAATGG - Intronic
1049957210 9:704645-704667 GTCTCTGTTTGGAAGGCAAATGG - Intronic
1051358005 9:16257396-16257418 CTCTATGTTTGGAAAGAAAAAGG + Intronic
1052001161 9:23282826-23282848 CTTTGTGTATGGATAGAAAAGGG + Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1053009901 9:34627216-34627238 CTCTGTCTTTGGAAGCAGAATGG - Intronic
1053325455 9:37143524-37143546 TTCTGTGTATGAAAGAAAATAGG + Intronic
1054919647 9:70529275-70529297 CTTTGTGTATGGATGGACCACGG - Exonic
1054998017 9:71414403-71414425 CTTTGTGAAAGGAAGGAAAAAGG - Intronic
1055864531 9:80797145-80797167 CTCTGTGTGCTGAAAGAAAAGGG + Intergenic
1055964135 9:81848901-81848923 CTCAGAGTATGGGAAGAAAAAGG - Intergenic
1056534441 9:87515829-87515851 CTCTGAGAATGGGAAGAAAACGG - Intronic
1058511224 9:105719777-105719799 CTTAGTGTAAGGAATGAAAATGG + Intronic
1058747094 9:108002374-108002396 CTCTCTGTAAAGAGGGAAAATGG - Intergenic
1059058554 9:111010830-111010852 ATCTGTTTCTGGAAGGAGAAGGG - Intronic
1059502775 9:114769360-114769382 GTCTGTGTATGGAGGTAAATGGG + Intergenic
1059550039 9:115220084-115220106 CTGTGTGTATTTAAGAAAAAAGG + Intronic
1060575940 9:124694242-124694264 ATCTGTGTATGTATGGATAAAGG - Intronic
1060961867 9:127686501-127686523 GCTTGTGTATGTAAGGAAAATGG + Intronic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1186857660 X:13641096-13641118 TTCTGTGTTTTCAAGGAAAAAGG - Intergenic
1187768517 X:22669531-22669553 CCCTGTGTAAGGGAGGAGAAAGG - Intergenic
1187776999 X:22771528-22771550 TTCAGTATAAGGAAGGAAAAGGG - Intergenic
1188862846 X:35277633-35277655 GGCTGTGAATGGTAGGAAAATGG - Intergenic
1189833489 X:44998290-44998312 CTCTGTGAATAGAAGGAACATGG + Intronic
1193493679 X:82183843-82183865 ATGTGTGTATAGCAGGAAAAGGG + Intergenic
1193673604 X:84419443-84419465 CTTTGTCTTTGGAAAGAAAATGG + Intronic
1194240670 X:91443478-91443500 CTTTGTGTTTGTAAGGAAATTGG + Intergenic
1195382942 X:104288283-104288305 CACTGTGTCTGGAAGAAAAATGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196096122 X:111802045-111802067 TTTTGTGTATGGTATGAAAAAGG + Intronic
1196573831 X:117295438-117295460 CTCTGTGTTTGCACAGAAAAAGG + Intergenic
1197163456 X:123349582-123349604 CTTTTTGTAAAGAAGGAAAACGG - Intronic
1197557298 X:127971573-127971595 CTTTGTGAATGAAAAGAAAAGGG - Intergenic
1197976839 X:132174801-132174823 CTAAGTGGCTGGAAGGAAAATGG + Intergenic
1198442746 X:136679925-136679947 TCCTCTGTAAGGAAGGAAAATGG + Intronic
1198727627 X:139693122-139693144 CGCAGTGCCTGGAAGGAAAAGGG + Intronic
1198828582 X:140724780-140724802 CTGTGTGTATGGAATGAGTATGG - Intergenic
1199530518 X:148842169-148842191 CTGTGTGGATGGAAGAGAAATGG - Intronic
1199752387 X:150832682-150832704 CTCTCTGTAGGAAAGGAAGAAGG + Intronic
1200274949 X:154723287-154723309 CACTGTGCATGTAAAGAAAAAGG + Intronic
1200283022 X:154794630-154794652 CACTGTGTGGGGAAGGAGAAGGG + Intronic