ID: 927964972

View in Genome Browser
Species Human (GRCh38)
Location 2:27262833-27262855
Sequence CCCCGGGACCGCGGTGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927964972_927964982 12 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964982 2:27262868-27262890 AGTGGTCTCCAAGCCCCCAGCGG 0: 1
1: 0
2: 1
3: 22
4: 198
927964972_927964983 16 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964983 2:27262872-27262894 GTCTCCAAGCCCCCAGCGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 175
927964972_927964980 -6 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964980 2:27262850-27262872 CCGGGGGCTCACCAGGCGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 132
927964972_927964986 22 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964986 2:27262878-27262900 AAGCCCCCAGCGGCTGGAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 261
927964972_927964985 21 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964985 2:27262877-27262899 CAAGCCCCCAGCGGCTGGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927964972 Original CRISPR CCCCGGGACCGCGGTGGCGC CGG (reversed) Exonic
900210918 1:1455532-1455554 GCCTGGGACCGGGGAGGCGCAGG + Intronic
900223823 1:1523580-1523602 GCCTGGGACCGGGGAGGCGCAGG + Intronic
901183665 1:7358542-7358564 GCCCGGGGCAGGGGTGGCGCGGG - Intronic
902600883 1:17539668-17539690 CCCCGGGACCGGGCGGGCGGGGG + Intergenic
908128204 1:61050700-61050722 CCACGGGACAGCGGCCGCGCGGG + Intronic
917565365 1:176207216-176207238 TACAGGGACCGCGGTGGCGGCGG - Exonic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
919826481 1:201506969-201506991 CCCCGGGGCTGCGGCGGGGCTGG + Intronic
921046104 1:211479070-211479092 CTCCAGGACCGCAGTGGCGGCGG + Exonic
921229185 1:213051330-213051352 AACCTGGACCGCGGCGGCGCCGG + Exonic
921923212 1:220690720-220690742 CCCCCGGGCAGTGGTGGCGCAGG - Intronic
1064290606 10:14030893-14030915 GCCAGGGACTGCGGTGGGGCTGG - Intronic
1069698436 10:70404640-70404662 CCCCGGGGCTTCGGTGGAGCTGG - Intronic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1072420953 10:95290533-95290555 CCCCGGAAGCGCGGCGGGGCGGG - Intronic
1072891621 10:99329767-99329789 CCCCGGGACCGCAGCGCTGCAGG + Exonic
1073286738 10:102394252-102394274 CTCCCGGCCCGGGGTGGCGCTGG + Intronic
1074182580 10:111077296-111077318 CTCCGGGACGGCGGCGGCGGCGG - Exonic
1074829992 10:117241333-117241355 CCCCGGGGCAGCCGGGGCGCAGG + Intronic
1075430296 10:122374764-122374786 AGCCGGGGCCGCGGCGGCGCGGG + Exonic
1076750113 10:132538117-132538139 CCCGGGCACCGCGGTGCTGCTGG + Exonic
1077297458 11:1832723-1832745 CCCCAGGACCCTGGGGGCGCTGG - Intronic
1077476229 11:2791740-2791762 CCCCAGGTCAGAGGTGGCGCTGG + Intronic
1091460884 12:642908-642930 GCCCGGGAGCGCGAGGGCGCAGG - Intronic
1092218871 12:6700023-6700045 CCCAGGGACTGGGTTGGCGCTGG - Intronic
1096101236 12:48971609-48971631 CCCGGCGGCCGCGGCGGCGCTGG - Exonic
1097281027 12:57845740-57845762 CCCCGGGACCTTGGCGGCGTCGG - Intronic
1100444817 12:94650581-94650603 CCCCGCGGCGGCGGCGGCGCAGG - Intergenic
1101254715 12:102965750-102965772 TCCCGGGCCCGCGGGGGAGCAGG - Intergenic
1103595457 12:122022286-122022308 CCCGGGGCCCGCGGCGGGGCTGG - Intronic
1104448767 12:128853361-128853383 CCCTGGGTGCGGGGTGGCGCGGG - Intergenic
1110450844 13:75636252-75636274 CCCCGGGAGGGCGGTGGGGTGGG + Intronic
1113552567 13:111204639-111204661 CCCTGGGACCACGATGGAGCTGG - Intronic
1113927753 13:113950914-113950936 CCCCGGGATGTCCGTGGCGCTGG + Intergenic
1114483249 14:23048048-23048070 CCCCGGCCCCGCGGAGCCGCTGG - Exonic
1118797138 14:69153388-69153410 CCTGGGGACCTGGGTGGCGCCGG + Intergenic
1121279383 14:92688178-92688200 CCCCTGGACGGTGGTGGCGGCGG + Exonic
1122743101 14:103883016-103883038 CCCTGGGACCGGGCTGGAGCCGG - Intergenic
1123630761 15:22258251-22258273 CGCCGGGACCGGGGGCGCGCGGG - Intergenic
1129108247 15:73323244-73323266 CCCCGGGCCCCGGGTGGCGCGGG + Exonic
1129162219 15:73753160-73753182 CCCCGGGAGCCCGGCGGGGCAGG - Intergenic
1129189207 15:73927659-73927681 CCCCGGTCCCGAGGCGGCGCAGG + Exonic
1129483337 15:75844180-75844202 TCCCGGGACCGGGGCGGGGCGGG + Intronic
1132098438 15:99005573-99005595 GCCGGGGACCGGGGTGGAGCGGG + Intronic
1132186757 15:99807163-99807185 TCCCGGGACCGCGACGGGGCGGG + Intergenic
1132428930 15:101745548-101745570 TCCCGGGACCGCGACGGGGCGGG - Intronic
1135607364 16:23836117-23836139 CCCCGGGGCCGCGGGACCGCGGG - Exonic
1138327955 16:56191299-56191321 CCCCGGGACGGGGAGGGCGCGGG - Intergenic
1139325965 16:66152729-66152751 CCCAGGGACCGGGGTGGGGGTGG - Intergenic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1141906932 16:87033105-87033127 CCCCGGGGCCGCCCTGGCGTGGG - Intergenic
1141972282 16:87492322-87492344 CGCCGGGACCGGGGACGCGCGGG + Intergenic
1142271865 16:89094013-89094035 CCACGGGACCGCGGCGGGGTCGG + Intronic
1142474618 17:181516-181538 CCCCCGGGCCGGGGTCGCGCCGG - Exonic
1142622040 17:1171421-1171443 CCCCGGGGCATCGGTGGAGCTGG - Intronic
1143023008 17:3926301-3926323 CCCAGGGACTGCAGTAGCGCTGG + Intronic
1146022639 17:29292913-29292935 CCCCTGCACTGCGGGGGCGCCGG - Intronic
1147139686 17:38454064-38454086 CCCCGGAACCGCGCTGCCTCTGG + Intronic
1148323635 17:46771482-46771504 CCCCGGGAACGCGGGGGCGGCGG + Intronic
1149430656 17:56593888-56593910 TCCCGGGCCGGCGGCGGCGCAGG - Exonic
1151703155 17:75753902-75753924 CCCCCGGACGACGGCGGCGCGGG + Exonic
1151938869 17:77280942-77280964 GCCGGGCACCGCGGCGGCGCCGG - Intronic
1152049225 17:77959215-77959237 CCGCGGGGCTCCGGTGGCGCGGG - Intergenic
1152360802 17:79832282-79832304 ACCCGGGAACGCGGCGGCGGTGG - Intergenic
1152396260 17:80035645-80035667 CCGCGGGACCGGGGAGGGGCCGG - Intronic
1152728974 17:81960780-81960802 CCCGCGGACCGAGGCGGCGCCGG - Exonic
1152744138 17:82031473-82031495 CCCCCGGGCCGGGGTCGCGCTGG + Intergenic
1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG + Exonic
1153280802 18:3412165-3412187 CCTCGGGATCGCGGCGGGGCCGG - Intronic
1153514453 18:5891255-5891277 CCCGGGGGCTGCGGTGGCTCCGG - Exonic
1153565698 18:6415020-6415042 CCCGGGGAGCCGGGTGGCGCTGG + Intronic
1153805312 18:8705335-8705357 CACCGGTGCCGCGGCGGCGCTGG - Intergenic
1154125693 18:11689983-11690005 CGCCGGGCCCGCGGGGGCGGCGG + Intronic
1155508234 18:26550964-26550986 CCCGGGGGCCGCGCTGGCTCCGG + Intronic
1157095101 18:44680206-44680228 CCCCGGGCGCGCGGAGGCGGCGG - Intronic
1158954160 18:62523599-62523621 CCCCGGGGCGGCGGCGGCGGCGG - Exonic
1158954701 18:62526617-62526639 CCCCGGGTGCGCGGCGGCGGCGG - Intronic
1160411661 18:78679195-78679217 CCCAGGGACCTCGCAGGCGCTGG - Intergenic
1160734190 19:654359-654381 CACCGGGGGCGCGGTGGCTCAGG + Intronic
1160898890 19:1416786-1416808 CCCCAGGACGGGGGTGGCGCGGG + Intronic
1161101817 19:2425276-2425298 GCCCGGGGCCGCGGTGGTGCGGG + Intronic
1161114612 19:2489461-2489483 GCCTGGGGCCGCGGTGGCACAGG + Intergenic
1161495621 19:4584379-4584401 CCCCGGGTCCGAGGAGGCCCGGG + Intergenic
1162001002 19:7745066-7745088 CCCAGGGACAGGGGTGGCACAGG + Exonic
1162070497 19:8149519-8149541 CCCCGGGTCCCCGGCGCCGCAGG - Exonic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162751762 19:12833860-12833882 CGCGGGGACCGCGGCGGCGGCGG - Intronic
1163358314 19:16829458-16829480 CCCCCGGCCCGCGGGGCCGCCGG - Exonic
1163516394 19:17766600-17766622 CCCCGGGACAGCGCTGGCACTGG - Intronic
1165419866 19:35717529-35717551 CCCCGGGACCCCCGAGGCCCTGG - Intergenic
1166361411 19:42254277-42254299 CCCCGGGCCACCGGTGGCGCGGG + Intronic
1167251008 19:48398460-48398482 CTCCGGGAACGGGCTGGCGCAGG - Exonic
1167311294 19:48739345-48739367 CCCCGGAGGCGCCGTGGCGCGGG + Exonic
927053421 2:19350618-19350640 CCGCGGGACCGCGCAGGCGGTGG - Intergenic
927702628 2:25277477-25277499 TCCGGGGCTCGCGGTGGCGCTGG + Intronic
927714283 2:25342106-25342128 CCCCGCGGCCGCGCTGGCCCCGG + Intronic
927964972 2:27262833-27262855 CCCCGGGACCGCGGTGGCGCCGG - Exonic
931711001 2:64989166-64989188 ACCCGAGGCCGCGGGGGCGCGGG - Intronic
932681401 2:73829008-73829030 TCCCGGGAACGTGGTGGGGCAGG + Exonic
935396911 2:102619391-102619413 CCCAGTGACCGCGGGGGCGATGG - Intergenic
935746510 2:106194084-106194106 CCCCGGCGCCGCGGTGGGCCGGG - Intronic
936433182 2:112482009-112482031 CCCGGGGGCGGCGGCGGCGCAGG - Intergenic
937979515 2:127606700-127606722 CCCAGGGACTGCTGTGGCCCAGG + Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
940211636 2:151261565-151261587 CCCAGGGACCCCGGGGGCCCCGG - Intronic
946692465 2:222319697-222319719 CACCGGGCACGCGATGGCGCCGG + Intergenic
947518750 2:230828505-230828527 GCCCGGGCCCGCCGCGGCGCTGG - Intergenic
947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG + Exonic
948140478 2:235669508-235669530 TCCCGGGAGCGCGGCGGCGGCGG - Intronic
948467436 2:238159069-238159091 CCCCAGGCCCGCGGCGGCGGCGG - Exonic
1172288368 20:33757254-33757276 CACCGTGCCCCCGGTGGCGCTGG - Exonic
1175856123 20:62122046-62122068 CCCAGGGTCCGGGGCGGCGCCGG + Intergenic
1176024898 20:62980972-62980994 CCCGGGGACCCCGGTGGGTCTGG - Intergenic
1178274619 21:31225879-31225901 CCTCGCGACCGCAGTGGCGCAGG + Exonic
1178351022 21:31873303-31873325 CCCCGGGACCCAGGCGCCGCCGG + Exonic
1180190520 21:46160605-46160627 CCCCGAGACCGTGGGGGTGCCGG - Intergenic
1180190573 21:46160739-46160761 CCCCGAGACCGTGGGGGTGCTGG - Intergenic
1180947409 22:19704116-19704138 CTCAGGGACCGGGGTGGGGCAGG + Intergenic
1181006426 22:20016001-20016023 CACCGGCACCGAGGGGGCGCAGG + Intronic
1181387593 22:22557465-22557487 ACCCGGGACAGGGGTGGTGCTGG + Exonic
954289548 3:49642479-49642501 CCCCGGCACTGAGGTGGCCCTGG - Exonic
954401364 3:50321394-50321416 GCCCGGGATGGCGGTGGCCCTGG - Exonic
961182427 3:124887193-124887215 TCCCGGGACCGCGGCTGCCCTGG + Exonic
961389202 3:126542417-126542439 CCCCGGGGCCGCGGCGGCCCAGG - Exonic
962793985 3:138834998-138835020 CCCGGGCCCCGCGGTGGCGGCGG + Intergenic
962873153 3:139515680-139515702 CCCCTGCACCGCTGTGGCCCTGG - Intergenic
963081845 3:141402240-141402262 CCCCGGGCCCGCGGGGCTGCGGG + Intronic
967904051 3:194486630-194486652 CCCAGGGACCGCGGGGGACCCGG + Intronic
968093041 3:195909767-195909789 CCCCGGGGCGGCGCAGGCGCAGG - Intronic
968726122 4:2248579-2248601 CCCCTGGACCCCAGTGGGGCCGG + Exonic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
975444335 4:74445157-74445179 TCCCGGGACCTCTGGGGCGCTGG - Exonic
975870613 4:78775872-78775894 TCCCGGGTCCGGGGTTGCGCCGG - Intergenic
976388072 4:84482862-84482884 CCCGGGGTCAGCGGAGGCGCAGG + Intergenic
980633970 4:135474073-135474095 CCCAGGGCCCCCGGTGGTGCAGG + Intergenic
984206488 4:176792837-176792859 GCCCGGGAGCGCCGCGGCGCAGG + Intergenic
985688415 5:1294211-1294233 CCCCGGGTGCGAGGAGGCGCGGG - Exonic
986682742 5:10248992-10249014 GCCGGGCACCGCGGTGGCTCAGG + Intronic
986721443 5:10563883-10563905 CCCCCGGACCTGGGTGGGGCCGG - Intergenic
987374014 5:17217833-17217855 CCCCGGGTCCGCGGCGGCGCGGG - Intronic
990742098 5:58922684-58922706 CCCTGGGACATCGGTGGGGCTGG - Intergenic
992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG + Intronic
993651634 5:90529495-90529517 ACCCGGGACAGCGGCGGCGGCGG - Exonic
994043494 5:95284238-95284260 CCCCTGGAGCCCGGCGGCGCCGG - Exonic
1001381986 5:171311329-171311351 ACCCGGCACCGCGGGGCCGCCGG - Intronic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1001650925 5:173315856-173315878 CCCAGGGAGCCCGGTGGCGGGGG + Exonic
1001773412 5:174312019-174312041 ACCCGGGCGCGCGGGGGCGCGGG + Intergenic
1001933943 5:175691516-175691538 CCCAGGGACCGTGATGGGGCGGG + Intergenic
1002355706 5:178627226-178627248 CCCCGGGACCGGGTGGGCGGGGG - Intronic
1003911491 6:10747768-10747790 CCCCGGGGCCGCGGCAGGGCGGG - Exonic
1006472656 6:34237328-34237350 CCCGGGGCCCGCGGCGGCGGCGG + Intronic
1007625383 6:43243620-43243642 CCCCGGGGCCGGGGCGGGGCGGG - Intergenic
1011517134 6:88166595-88166617 CTCCGGGAGCGCGGCGGCGGAGG - Intergenic
1014029205 6:116681489-116681511 CCCCGCGACCGCTGTCGCCCTGG - Intronic
1016433193 6:144008578-144008600 CCCAGGTACAGCGCTGGCGCAGG + Intronic
1019614531 7:1953139-1953161 CCCTGGGACCAGGGTGGGGCGGG - Intronic
1021106786 7:16646527-16646549 CCCTGGGACCGCGGGCGGGCGGG + Intronic
1023972286 7:45000229-45000251 CGCCGGGAGCGCGGGGGCGGCGG + Intronic
1024089107 7:45921062-45921084 CCGCGGGCCGCCGGTGGCGCGGG - Exonic
1029467677 7:100736591-100736613 CCCGGGGGCCCCGGTGGAGCCGG - Exonic
1034306286 7:150047676-150047698 CCCCGGGAGCGCGGCGGCGGCGG - Intergenic
1034800561 7:154052977-154052999 CCCCGGGAGCGCGGCGGCGGCGG + Intronic
1036454199 8:8893412-8893434 CCGCGGGACCGCGGCTGCGAGGG - Exonic
1036910538 8:12754575-12754597 CCCCGGGGCCGCTGGGCCGCTGG - Intronic
1037273927 8:17157160-17157182 CCCCGGGACCGCTGTGGAGAGGG + Intronic
1037529066 8:19756876-19756898 CCCCGGGAGCGCAGCGGCCCCGG + Intronic
1039884312 8:41646606-41646628 CCCCGGGCCCCGGGCGGCGCGGG - Exonic
1042837861 8:73093372-73093394 CCCGGGGACCTCCGGGGCGCGGG + Intronic
1049354845 8:142182520-142182542 CCCTGGGTCCGCTGTGGGGCAGG + Intergenic
1053372659 9:37576010-37576032 CCGGGGGACCGCGGAGCCGCGGG + Intronic
1057489131 9:95508312-95508334 CCCCAGGACCGCGGCGGCGGCGG - Exonic
1057916101 9:99056350-99056372 CCCGGGGGCCCCGGTGGCCCAGG - Exonic
1058990983 9:110255646-110255668 CCACGGGACTCCTGTGGCGCAGG - Intronic
1059470983 9:114504888-114504910 CCCCGGGAGCGCGGAGACGACGG + Exonic
1061235953 9:129342746-129342768 CCCCGGGAGGGGGGTGGCACTGG + Intergenic
1061236251 9:129344242-129344264 CCCCGGGAGGGGGGTGGCACCGG + Intergenic
1062091303 9:134679958-134679980 CCCCGGGAGTGGGGTGGTGCCGG + Intronic
1062461594 9:136664696-136664718 CCCCAGGACCGGGGAGGCACAGG + Exonic
1062600354 9:137316391-137316413 CCCAGGGGCCGCGGGGTCGCTGG + Intronic
1186426274 X:9465826-9465848 CCCGGAGCCCGCGGTGGCGCAGG - Intronic
1189324669 X:40105338-40105360 CCCCGTGACTGCGGCGGCGGCGG - Intronic
1189325559 X:40109013-40109035 TCCCGGGAACGCGGCGGCGGCGG + Intronic
1193819889 X:86148658-86148680 CCCCGGGACGCCGGCGCCGCTGG - Exonic
1198024878 X:132695039-132695061 CCCCAGGGACGAGGTGGCGCTGG + Intronic
1198085593 X:133279021-133279043 ACCCAGGACCCTGGTGGCGCAGG - Intergenic
1198530602 X:137547389-137547411 CTCCCGGACCGCGGTGGCGCAGG + Intergenic
1200292560 X:154886617-154886639 CCACGGGCCCGGGGAGGCGCTGG + Exonic
1200339404 X:155382357-155382379 CCACGGGCCCGGGGAGGCGCTGG + Exonic
1200347066 X:155458336-155458358 CCACGGGCCCGGGGAGGCGCTGG - Exonic