ID: 927964972

View in Genome Browser
Species Human (GRCh38)
Location 2:27262833-27262855
Sequence CCCCGGGACCGCGGTGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927964972_927964986 22 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964986 2:27262878-27262900 AAGCCCCCAGCGGCTGGAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 261
927964972_927964980 -6 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964980 2:27262850-27262872 CCGGGGGCTCACCAGGCGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 132
927964972_927964985 21 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964985 2:27262877-27262899 CAAGCCCCCAGCGGCTGGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 190
927964972_927964983 16 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964983 2:27262872-27262894 GTCTCCAAGCCCCCAGCGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 175
927964972_927964982 12 Left 927964972 2:27262833-27262855 CCGGCGCCACCGCGGTCCCGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
Right 927964982 2:27262868-27262890 AGTGGTCTCCAAGCCCCCAGCGG 0: 1
1: 0
2: 1
3: 22
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927964972 Original CRISPR CCCCGGGACCGCGGTGGCGC CGG (reversed) Exonic