ID: 927965345

View in Genome Browser
Species Human (GRCh38)
Location 2:27264504-27264526
Sequence CCGCCCGCACACCTTGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927965345_927965352 18 Left 927965345 2:27264504-27264526 CCCGTGCCAAGGTGTGCGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 105
Right 927965352 2:27264545-27264567 CCTGCGCCGCTGCTGCAGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 158
927965345_927965355 24 Left 927965345 2:27264504-27264526 CCCGTGCCAAGGTGTGCGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 105
Right 927965355 2:27264551-27264573 CCGCTGCTGCAGAGCGGCACGGG 0: 1
1: 0
2: 0
3: 12
4: 97
927965345_927965353 23 Left 927965345 2:27264504-27264526 CCCGTGCCAAGGTGTGCGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 105
Right 927965353 2:27264550-27264572 GCCGCTGCTGCAGAGCGGCACGG 0: 1
1: 0
2: 0
3: 14
4: 189
927965345_927965350 -10 Left 927965345 2:27264504-27264526 CCCGTGCCAAGGTGTGCGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 105
Right 927965350 2:27264517-27264539 GTGCGGGCGGCGCGTGCGAAGGG 0: 1
1: 0
2: 1
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927965345 Original CRISPR CCGCCCGCACACCTTGGCAC GGG (reversed) Intronic
900121482 1:1050300-1050322 AGGCCTGCACACCTTTGCACGGG + Exonic
900249364 1:1659317-1659339 CTGCTCGCAAGCCTTGGCACAGG - Intronic
900260303 1:1724628-1724650 CTGCTCGCAAGCCTTGGCACAGG - Intergenic
900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG + Intronic
919744290 1:200999279-200999301 CCGACCCCACACTTGGGCACTGG + Intronic
1065588131 10:27240416-27240438 CCGCCGACAGACCTTGGGACCGG - Exonic
1067152895 10:43751103-43751125 CACCCCCCACACCTTGGAACTGG + Intergenic
1067247314 10:44557777-44557799 ATGCCCGCACAGCTTGGCAGAGG + Intergenic
1070808955 10:79287943-79287965 CTGCCCCCTCACCCTGGCACTGG - Intronic
1071565136 10:86667780-86667802 CTGCCTGCACCCCTTGGCATAGG - Intergenic
1073185854 10:101614596-101614618 CTGCCCGCACAGCCTGGCAGGGG + Intronic
1073428885 10:103473245-103473267 CCGCGCCCCTACCTTGGCACTGG - Exonic
1077418464 11:2436904-2436926 CCGCTCGCCCACCTGGGCACTGG + Intergenic
1083170918 11:60923770-60923792 CCGACTGGAAACCTTGGCACAGG - Intergenic
1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG + Intergenic
1202811794 11_KI270721v1_random:30236-30258 CAGCCTGGACACCTTGGAACTGG + Intergenic
1091413097 12:257259-257281 CAGCCCGCTTACCTTGGCAAAGG + Intronic
1092263334 12:6963668-6963690 CAGCCCGCCCACCTTGGGTCAGG - Intergenic
1096545433 12:52335885-52335907 CTGCCCACAAACCCTGGCACTGG + Intergenic
1097192204 12:57224971-57224993 CCGTCCGAAGACCTTGGCTCTGG - Exonic
1106559288 13:30834471-30834493 CGGCCCTCCCAGCTTGGCACAGG + Intergenic
1113201108 13:107867773-107867795 CCGCCCGCACGCTCTGGCTCCGG + Intergenic
1113910997 13:113841180-113841202 CCCGCCGCTCACCCTGGCACCGG - Intronic
1114265817 14:21071835-21071857 TCGCCCACACACCTTGGGGCCGG + Intronic
1114266927 14:21078197-21078219 AGCCCAGCACACCTTGGCACAGG - Exonic
1114486033 14:23062228-23062250 CCACCCGCACAGCTCTGCACGGG - Exonic
1121421785 14:93821078-93821100 CCGCCCCTGCACCTTGGCTCAGG + Intergenic
1122436946 14:101706857-101706879 CTGCCTGCACACCCTGGGACAGG + Intergenic
1122998866 14:105281160-105281182 CCACCTGCACACCTGGGCTCAGG - Intronic
1132629486 16:910309-910331 CCGCCCCCACACCAGGGCCCAGG + Intronic
1132670820 16:1101714-1101736 CGGCCCACACACCGGGGCACGGG - Intergenic
1134108647 16:11501076-11501098 CCACCCTCACACCTTGGGAGGGG + Intronic
1135234308 16:20741483-20741505 CCGCCCGCCCACCCCGGGACCGG + Intronic
1136460632 16:30407971-30407993 CCCCCCGCCCACCGTGGCCCTGG - Intronic
1137791832 16:51181583-51181605 CTGCCCCCACACATTGTCACTGG - Intergenic
1140469886 16:75208015-75208037 GCGCCAGCACACCTGGGCCCTGG + Intergenic
1141769424 16:86080344-86080366 CTGCCTGCACTCCTTGGCCCCGG - Intergenic
1141839764 16:86567168-86567190 CCGCCCGCGCACCCTCGCCCCGG + Intergenic
1142243169 16:88956311-88956333 TCTCCCGCCCACCCTGGCACAGG - Intronic
1142293259 16:89202097-89202119 CCGCCCGCCCTCCTCGGCGCTGG + Intergenic
1142299450 16:89247827-89247849 CTGCCCGCCCTCCTCGGCACTGG + Intergenic
1143019133 17:3907614-3907636 GCCCCCTCTCACCTTGGCACTGG + Intronic
1143422072 17:6801242-6801264 CTGCCTGCTCACCTTGGTACAGG + Intronic
1145284902 17:21498088-21498110 CTTCCTGCCCACCTTGGCACAGG - Intergenic
1145392618 17:22467664-22467686 CTTCCTGCCCACCTTGGCACAGG + Intergenic
1146186524 17:30727921-30727943 CTGCCCACACAACTTGGCATCGG + Intergenic
1149430612 17:56593702-56593724 GCGTCCGCGCACGTTGGCACCGG - Exonic
1150473577 17:65457776-65457798 CCTTCCTCACTCCTTGGCACTGG + Intergenic
1153555769 18:6311630-6311652 ACCCCCGCACTCCTTGGCAGTGG + Exonic
1155888047 18:31232401-31232423 CTCCCCACACACCATGGCACTGG + Intergenic
1160755872 19:756983-757005 CCTCAGGCACACCGTGGCACCGG + Exonic
1160791401 19:925365-925387 CCGCCCGCCCAGCTCTGCACCGG + Intergenic
1160799014 19:959035-959057 CCTCCCACACACCCAGGCACAGG - Intronic
1160881898 19:1324825-1324847 CCCCCCGCACACGCGGGCACAGG - Intergenic
1161316866 19:3621296-3621318 CCGCCCACACAGCGGGGCACAGG + Intronic
1161342556 19:3751177-3751199 CCACCCGCACACCTCGCCATAGG + Exonic
1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG + Exonic
1163699727 19:18781211-18781233 GCGCCCGCACGCCCTGGCCCAGG - Exonic
1166571328 19:43798800-43798822 TCTCCCGCGCACCTTGGCTCAGG + Exonic
1168126352 19:54285688-54285710 CCACCCGAACACCGTGGCCCTGG + Intergenic
1168175540 19:54625176-54625198 CCACCCGAACACCGTGGCCCTGG - Intronic
925730761 2:6918052-6918074 CCGCCCGCAGACCCTGGGGCTGG + Intronic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
933051903 2:77611252-77611274 CAGGCTGCACACCATGGCACTGG - Intergenic
933766207 2:85711298-85711320 CTCCCCGCACTCCTTGGCACTGG - Intergenic
935375235 2:102388693-102388715 ACGCACGCACACATTGGCACGGG - Intronic
936957832 2:118041029-118041051 CAGCCCGCAAACATTGTCACTGG - Intergenic
937317959 2:120943937-120943959 TTGCCCCCACACCTTGGCTCAGG + Intronic
1171519884 20:25767632-25767654 CAGGCCGCACACCTGGGCACAGG - Intronic
1171557035 20:26088861-26088883 CAGGCCGCACACCTGGGCACAGG + Intergenic
1175895736 20:62334861-62334883 CCTCTCCCACACCCTGGCACAGG + Intronic
1176150089 20:63586286-63586308 CTTCCAGCACACATTGGCACGGG - Intergenic
1176654021 21:9573921-9573943 CAGGCTGCACACCTGGGCACAGG - Intergenic
1178351200 21:31873889-31873911 CCCCTCGCGCACCTTGGCAAAGG - Exonic
1181002146 22:19992848-19992870 CCTCCAGCACACCCTGGCTCTGG + Intronic
1183949256 22:41343566-41343588 CAGCCCACCCACCTTTGCACAGG - Exonic
1185047592 22:48536878-48536900 GCCCCCGGACACCCTGGCACTGG + Intronic
949300822 3:2581978-2582000 CCTCCCTCACTCCTTGGCTCTGG - Intronic
954632083 3:52053098-52053120 CCACCCCCACACCTTGCCACTGG + Intronic
960184778 3:114625000-114625022 GCGACTGCACAGCTTGGCACAGG + Intronic
960928213 3:122817300-122817322 CCGCCCGCATTCGTTGGCTCAGG - Intronic
961326597 3:126112753-126112775 CCGCCCGCAGACCCTGGGGCAGG + Intronic
961403327 3:126662451-126662473 CCGCCTCCACAGCATGGCACCGG + Intergenic
969376262 4:6765361-6765383 CCTTCTGAACACCTTGGCACAGG + Intergenic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
978576950 4:110197771-110197793 CCGCCCGCCGCCCTTGGCCCTGG - Intronic
981186558 4:141810518-141810540 CCGACCTCACACTATGGCACAGG - Intergenic
985558774 5:571006-571028 CCTCCCGCACACCTGTGCCCAGG + Intergenic
992134006 5:73724027-73724049 GCCCCCGCAGACCCTGGCACAGG - Intronic
992228723 5:74642518-74642540 GCTCCCCCACACCTTGCCACAGG - Intronic
997511603 5:134458492-134458514 CAGCCCACGCACCCTGGCACAGG - Intergenic
999195802 5:149780831-149780853 CCACCTGCAAACATTGGCACGGG + Intronic
1002365042 5:178703229-178703251 CCCTCCGCACACCTGTGCACAGG - Intergenic
1003049469 6:2766240-2766262 CCGCCCGCACCCCCGGGCGCTGG + Exonic
1006678787 6:35782198-35782220 CCGCCCCCAGACCTTTGCCCTGG - Intronic
1007177191 6:39905082-39905104 TTGCCAGCACACCTTGGCATAGG + Exonic
1013836703 6:114342821-114342843 GCGCCCGCACAGCTTGGCACCGG - Exonic
1019323378 7:425611-425633 GGGCCCGCACACCTGGGGACCGG + Intergenic
1025280367 7:57622585-57622607 CAGGCTGCACACCTGGGCACAGG - Intergenic
1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG + Intergenic
1033518444 7:142134046-142134068 CAGCCCATACACATTGGCACTGG - Exonic
1034111002 7:148537452-148537474 TCGCCCCCACCCCATGGCACCGG + Intergenic
1035129625 7:156640323-156640345 CCGCCCGCCCACCTGGGCCTGGG - Exonic
1035892388 8:3359148-3359170 CTACCCACACACCTTGGCAGAGG + Exonic
1049492483 8:142912715-142912737 CCGTCCGCAGACATTGGTACAGG - Exonic
1050537794 9:6645470-6645492 CAGCCCCCACGCCCTGGCACAGG + Exonic
1053005319 9:34600445-34600467 CCGCCCCCACACCTGGACCCAGG + Intergenic
1056464317 9:86838938-86838960 CCGCACGCACACGTAGGCACAGG - Intergenic
1057354631 9:94323248-94323270 CTGCCCCCACACCCTGGAACTGG - Intronic
1057653126 9:96934387-96934409 CTGCCCCCACACCCTGGAACTGG + Intronic
1062617246 9:137403435-137403457 CAGCCAGCACACCCTGGCCCAGG + Intronic
1203631741 Un_KI270750v1:77373-77395 CAGGCTGCACACCTGGGCACAGG - Intergenic
1186424789 X:9455438-9455460 CTGCCGGCATTCCTTGGCACGGG - Intergenic
1190734050 X:53243538-53243560 CCACCCCCACACCCAGGCACGGG + Intronic
1195803350 X:108736205-108736227 CCGACCGCACTCATTGGGACCGG - Exonic