ID: 927966338

View in Genome Browser
Species Human (GRCh38)
Location 2:27271930-27271952
Sequence CACCTTTCGCATCTTGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927966338_927966340 20 Left 927966338 2:27271930-27271952 CCTCTGTCAAGATGCGAAAGGTG 0: 1
1: 0
2: 1
3: 12
4: 79
Right 927966340 2:27271973-27271995 CCGAATTTGCCTTCTTTCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 167
927966338_927966341 21 Left 927966338 2:27271930-27271952 CCTCTGTCAAGATGCGAAAGGTG 0: 1
1: 0
2: 1
3: 12
4: 79
Right 927966341 2:27271974-27271996 CGAATTTGCCTTCTTTCTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927966338 Original CRISPR CACCTTTCGCATCTTGACAG AGG (reversed) Intronic
904306522 1:29593676-29593698 CAGCTTTCTCATCTGGAAAGTGG - Intergenic
904356649 1:29944614-29944636 CCCCTCGCGCAGCTTGACAGAGG - Intergenic
904943173 1:34178868-34178890 CACGTTTTGCATCTTCAAAGTGG + Intronic
907913352 1:58846523-58846545 CACGTTTCTCATCTTGGCAGTGG - Intergenic
910277254 1:85463027-85463049 CAGTTTTCGCATCTATACAGTGG - Intronic
919895130 1:202004904-202004926 CAACTTTCACATAGTGACAGAGG - Intronic
923754162 1:236774994-236775016 CACCTTTCTCATTTTCACTGGGG + Intergenic
1064150364 10:12858169-12858191 GATCTTTCTCATATTGACAGGGG - Intergenic
1067983922 10:51120357-51120379 CACCTTTTTCCTCTTCACAGGGG - Intronic
1068394653 10:56445655-56445677 CATCTGTCTCATGTTGACAGTGG + Intergenic
1069606069 10:69739528-69739550 CACCTCTCGCATTGTTACAGTGG + Intergenic
1070393300 10:75989712-75989734 CACCTTTCTCATCTGCAAAGTGG - Intronic
1072367553 10:94728978-94729000 CACCTTCAGTATCTTGAAAGCGG - Intronic
1072715902 10:97752487-97752509 CACATTTTGCATCTTGACCCAGG + Intronic
1072844964 10:98819223-98819245 CTCCTTTCTGATCATGACAGGGG - Intronic
1073053578 10:100685125-100685147 CACCTTTCTCATCCTGATTGTGG - Intergenic
1074421341 10:113311382-113311404 CTCCTTAGGCATCTTGACAGTGG - Intergenic
1076707315 10:132308731-132308753 CCCCTGTCGCATCTGGACAAGGG - Intronic
1077238451 11:1496911-1496933 AACATTTTGCATCTTGACAGGGG + Intronic
1077407704 11:2389979-2390001 CACCTTCCGTATCTGGCCAGAGG - Intronic
1077971769 11:7200794-7200816 CATCTTTGCCATCTTGATAGGGG - Intergenic
1086590673 11:88510366-88510388 CACCAATCACATCTTGAGAGTGG - Intronic
1088889754 11:114035242-114035264 GACGTTTCTCCTCTTGACAGGGG + Intergenic
1090877879 11:130807062-130807084 CACATTTCACAGCTTGTCAGTGG + Intergenic
1096035235 12:48462038-48462060 CACCTTTCTCATCTTGACACTGG - Intergenic
1098683621 12:73390874-73390896 CACCTTTGGCATTTTGCTAGTGG + Intergenic
1118245373 14:64105044-64105066 CACCTGTCACATCCTGTCAGTGG + Intronic
1128670677 15:69572674-69572696 CACCTTTCCCAGTTTGCCAGGGG - Intergenic
1130105134 15:80923244-80923266 CAACAGTCTCATCTTGACAGAGG + Intronic
1130132287 15:81154140-81154162 CACCTTTAGCATCCTGCCAGCGG + Intergenic
1134896862 16:17896070-17896092 CACCCTTCGCCTCATGACAAAGG + Intergenic
1139345909 16:66303716-66303738 CACCTTTCCCAGCCTTACAGGGG - Intergenic
1141832966 16:86519962-86519984 CACCTCCCGCACCTGGACAGAGG - Intergenic
1141853321 16:86663207-86663229 CACCTTACTCATCTTGTAAGTGG + Intergenic
1145846465 17:28042470-28042492 CACCCTTGGAATCTTGAAAGAGG - Exonic
1151675053 17:75592971-75592993 CAGCTTTCTCATCTACACAGTGG - Intergenic
1158966258 18:62624799-62624821 CAACTGTCGCAGCTTGCCAGAGG - Intergenic
1160821644 19:1061823-1061845 CACGTTTCGCATGGTGACGGGGG + Exonic
1161875945 19:6909669-6909691 CATCTTTCTCATCTTTTCAGGGG + Intronic
1166662303 19:44654937-44654959 CAACTTTCTCATCTAGACAATGG - Intronic
1166813308 19:45526927-45526949 CACCTTTAGCTTCTTGAAAATGG + Exonic
927966338 2:27271930-27271952 CACCTTTCGCATCTTGACAGAGG - Intronic
929889030 2:45904577-45904599 GACATTTCGCTTCTTGGCAGGGG - Intronic
931875764 2:66510086-66510108 TACCTTTTGCATATTGAAAGTGG + Intronic
935270399 2:101429614-101429636 CACCTCTGGCATCTTGAGAATGG - Intronic
939383919 2:141471887-141471909 CATCTTTCTCATCTTGATAGTGG - Intronic
946721233 2:222610813-222610835 CAGCTTTCTCATCTGTACAGTGG - Intronic
1170056499 20:12210835-12210857 CATTTTTGGCATCTTGACAAAGG + Intergenic
1173555795 20:43964715-43964737 TACCTTGCTCATCTTGACAGTGG + Intronic
1177347600 21:19893475-19893497 CACATTTTGGATCTTGACAGTGG + Intergenic
1182449462 22:30410395-30410417 CAGCCTTCCCATCTTTACAGTGG - Intronic
1183099481 22:35575129-35575151 CTCCTTCGGCATCTTGTCAGAGG - Intergenic
950089656 3:10286701-10286723 CACCTTTGGCCTCTTCCCAGAGG + Exonic
955948063 3:64214186-64214208 CACCCTTCAAAACTTGACAGGGG + Intronic
956783727 3:72624954-72624976 CAACATTCACATTTTGACAGAGG - Intergenic
965415765 3:168390344-168390366 CACCTTTCTCATTTTGATTGTGG - Intergenic
967336721 3:188352331-188352353 CACCTTTGGCAGCTTGTGAGCGG + Intronic
968083620 3:195863940-195863962 CCCCTTCCACATCTTGGCAGGGG + Exonic
968501098 4:950477-950499 GACCTTTCTCATCGTGACAGTGG + Exonic
968882059 4:3306150-3306172 CACCCTTCGTCTCTTTACAGAGG + Intronic
973705245 4:53574307-53574329 CACCTTTCACATCCTCACATTGG + Intronic
974678186 4:65123892-65123914 CACCTTTAGTTTCTTGACTGTGG + Intergenic
981200944 4:141978912-141978934 CACCTTCCGCATCCTGCCACAGG + Intergenic
981413409 4:144459221-144459243 CTGCTTTAGCATCTTGAAAGAGG - Intergenic
982558300 4:156897524-156897546 CACCTTTCCTATCAGGACAGAGG + Intronic
982792808 4:159612995-159613017 CATCTGTCTCATGTTGACAGTGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
999202661 5:149827058-149827080 AACCTTTCCCACCTAGACAGAGG + Intronic
1001095001 5:168769187-168769209 GGCCTTTGGCATCCTGACAGTGG - Intronic
1002495822 5:179610674-179610696 CACCTTTTCCATCTTCAGAGCGG - Intergenic
1004788938 6:19002004-19002026 CATGTTTGGCATCTTGGCAGGGG - Intergenic
1016461598 6:144285119-144285141 CACCCTTCTCATCTGGAGAGCGG + Intergenic
1018959795 6:168440542-168440564 CGCCTTTGGCATCTTTACACGGG - Intergenic
1029844940 7:103403445-103403467 GACCTGTCTCATATTGACAGTGG + Intronic
1033177271 7:139136284-139136306 CAGCTTTCTCATCTTTACAGTGG + Intronic
1033821797 7:145143301-145143323 CTCCTTTGCCATCATGACAGTGG + Intergenic
1042193615 8:66212908-66212930 CACATTTGGCATCTGGACTGGGG - Intergenic
1042993816 8:74670764-74670786 CACCTTTCCAATCTTGACTCTGG - Intronic
1053589677 9:39499267-39499289 TACCTTTGGCAACTTGAAAGAGG - Intergenic
1054576619 9:66866040-66866062 TACCTTTGGCAACTTGAAAGAGG + Intronic
1055481724 9:76715143-76715165 CATCGTTCACATCTTCACAGTGG - Intronic
1055642137 9:78327513-78327535 CACCTTCCTCATCTGAACAGTGG - Intronic
1057289198 9:93789670-93789692 CACCTCTCCCATCCCGACAGTGG - Intergenic
1057476359 9:95406114-95406136 CTCCTTCCACATCTTGAAAGGGG + Intergenic
1061306851 9:129737285-129737307 CACCTTCCTCATCTAGAAAGCGG + Intergenic
1188201954 X:27302088-27302110 CATCTTTCTAATATTGACAGTGG - Intergenic
1196915016 X:120524852-120524874 CACCTTCAGTATCTTGAAAGCGG - Intronic
1197658769 X:129147303-129147325 CAGCCTTCGCATTTTGCCAGAGG - Intergenic
1199294671 X:146143561-146143583 TACGTTTCACATTTTGACAGAGG + Intergenic
1201390752 Y:13494558-13494580 CACCTGTCTAATATTGACAGTGG - Intergenic
1202261137 Y:22971677-22971699 CACCTTTAGCAACGTGACAGGGG + Intergenic
1202414125 Y:24605418-24605440 CACCTTTAGCAACGTGACAGGGG + Intergenic
1202456659 Y:25064668-25064690 CACCTTTAGCAACGTGACAGGGG - Intergenic