ID: 927968105

View in Genome Browser
Species Human (GRCh38)
Location 2:27284584-27284606
Sequence GGCATGAAGTCCTACATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927968096_927968105 21 Left 927968096 2:27284540-27284562 CCCTCTCGGGGGGCCTAGACCAA 0: 1
1: 0
2: 0
3: 1
4: 50
Right 927968105 2:27284584-27284606 GGCATGAAGTCCTACATGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
927968102_927968105 -10 Left 927968102 2:27284571-27284593 CCTCCTCGTCCTGGGCATGAAGT 0: 1
1: 0
2: 3
3: 10
4: 109
Right 927968105 2:27284584-27284606 GGCATGAAGTCCTACATGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
927968097_927968105 20 Left 927968097 2:27284541-27284563 CCTCTCGGGGGGCCTAGACCAAA 0: 1
1: 0
2: 0
3: 0
4: 45
Right 927968105 2:27284584-27284606 GGCATGAAGTCCTACATGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
927968099_927968105 2 Left 927968099 2:27284559-27284581 CCAAATGCTGTGCCTCCTCGTCC 0: 1
1: 0
2: 1
3: 69
4: 1262
Right 927968105 2:27284584-27284606 GGCATGAAGTCCTACATGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
927968098_927968105 8 Left 927968098 2:27284553-27284575 CCTAGACCAAATGCTGTGCCTCC 0: 1
1: 0
2: 1
3: 13
4: 178
Right 927968105 2:27284584-27284606 GGCATGAAGTCCTACATGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927968105 Original CRISPR GGCATGAAGTCCTACATGAG AGG Intronic
901367041 1:8761513-8761535 GGCATATAGTCTTACATGTGGGG - Intronic
904391159 1:30187078-30187100 TGCATGAAGTCATGAATGAGTGG + Intergenic
911713175 1:101098366-101098388 AGCATTAAGTCATTCATGAGGGG - Intergenic
912128210 1:106567398-106567420 AGCATGAAGTCTTACAAGAGAGG + Intergenic
915705029 1:157835760-157835782 GGAATGAAGACCAACAAGAGTGG + Intronic
918077925 1:181184385-181184407 TGCATGAAGATCTACTTGAGAGG + Intergenic
918546982 1:185696120-185696142 AGCATGAAGTTCTGCAAGAGTGG + Intergenic
922483594 1:225956438-225956460 GGCATCAGGTCCTCCCTGAGTGG + Intergenic
922887702 1:229032525-229032547 GCCATGAACTCTGACATGAGGGG + Intergenic
923013707 1:230109366-230109388 GTCCTGACGTCCCACATGAGTGG - Intronic
923294246 1:232577955-232577977 AGCATGAAGTCTTTCATGAAAGG + Intergenic
1063143491 10:3275881-3275903 GGCATGAAGCCCCACAGCAGTGG + Intergenic
1063579240 10:7290928-7290950 GGCTTGAAATCCAACATTAGTGG - Intronic
1065634228 10:27714087-27714109 GGGATTAAGTCATTCATGAGTGG + Intronic
1071038252 10:81274240-81274262 TGCATGAAATCCAACATAAGTGG - Intergenic
1071920228 10:90341656-90341678 GGCAGGAATTCTTACATGACAGG - Intergenic
1074839415 10:117334224-117334246 GGCATGAAGCCCAACATTACAGG - Intronic
1075992323 10:126848519-126848541 GGCAGAAAGTCCTACATGCTTGG + Intergenic
1077132314 11:979171-979193 GGGAGGACGTCCTAAATGAGAGG + Intronic
1077294809 11:1821284-1821306 TGCATAAAGTCATACATGGGAGG + Intergenic
1082286168 11:50320464-50320486 GGTGTGAAGTCCTCCATGGGAGG + Intergenic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1088740313 11:112761918-112761940 GGCATGAAGCCGTTCATGAGGGG + Intergenic
1089449361 11:118581851-118581873 GGCATAAAGTCTTAGAAGAGGGG - Intronic
1089810318 11:121126115-121126137 GGCAGGAAGTCCCACAGCAGGGG + Intronic
1090256677 11:125289261-125289283 GGCATGCAGTCAGTCATGAGGGG - Intronic
1096087342 12:48874611-48874633 GGCAGGAAGGCCTGCATGTGTGG - Intergenic
1100100734 12:91101364-91101386 CGGATAAAGTCCTCCATGAGTGG - Intergenic
1102439360 12:112949468-112949490 GGCCTCAAGTCCTACAGGATGGG + Intronic
1106621714 13:31376864-31376886 AGCACCAAGTCCCACATGAGAGG - Intergenic
1110266734 13:73546531-73546553 GGCACGAAGGCCTACAAAAGCGG - Intergenic
1112262502 13:97890048-97890070 GGCAGGAAGCCCAACAGGAGAGG + Intergenic
1119780462 14:77273639-77273661 GGCATGGAGGCCTACAGGATGGG - Intergenic
1127684867 15:61333469-61333491 GGCATCAAGTCCTACAAATGAGG - Intergenic
1128324060 15:66712135-66712157 GGCATGAAGTCTTTGTTGAGAGG + Intronic
1130754277 15:86746056-86746078 GGGATGAAGTACTAGGTGAGAGG - Intronic
1137479785 16:48842660-48842682 GGTATGAGGTCCTTCATGAGGGG + Intergenic
1139187670 16:64825862-64825884 AGCATTAAGTGCTAGATGAGTGG - Intergenic
1139589778 16:67927192-67927214 GGCCCCAAGTGCTACATGAGAGG + Intronic
1139657452 16:68397622-68397644 GGCAAGAAGTGCGACAGGAGAGG - Intronic
1141631228 16:85289185-85289207 GGCATGACCTGCTACATGGGAGG + Intergenic
1141961384 16:87411671-87411693 GCCATGAAGTTCTGCATGGGTGG + Exonic
1146650805 17:34605159-34605181 GCCATGACGTCCTAAGTGAGTGG + Intronic
1148337156 17:46849673-46849695 GGCATGAAGTCAGCCATGATGGG + Intronic
1151235383 17:72716146-72716168 GGCATGAGGTCATACAAGCGGGG + Intronic
1158026581 18:52905055-52905077 GCCATGACGTTGTACATGAGAGG - Intronic
1165289169 19:34869329-34869351 GGCCTGAAATCCTACATGGCAGG + Intergenic
1168681532 19:58319427-58319449 GGCGAGAAGCCCTACATGTGTGG + Intergenic
927968105 2:27284584-27284606 GGCATGAAGTCCTACATGAGAGG + Intronic
929267226 2:39931522-39931544 GGCACTAATTCATACATGAGGGG + Intergenic
938739063 2:134213875-134213897 TCCATGAAGTCCCACATGACAGG - Intronic
1171897119 20:30817926-30817948 GGCATGCAGCACTATATGAGAGG + Intergenic
1173691905 20:44967025-44967047 GGTCTGAAGTCCCACTTGAGGGG + Intronic
1174801308 20:53565307-53565329 GGCATTTAGTCCTACCTGGGTGG - Intergenic
1178627821 21:34233016-34233038 GGCTTCAAGTCCTGCATGTGAGG + Intergenic
1183601065 22:38840900-38840922 GGCATGGAGACCTGCAAGAGGGG + Intronic
949761130 3:7471998-7472020 GGCATGAATCCATTCATGAGGGG - Intronic
950967271 3:17155006-17155028 AGCATCAAGTCCTTCCTGAGGGG + Intergenic
951636873 3:24788856-24788878 GGCAGGAAGTCTTATATAAGAGG + Intergenic
959677905 3:109056946-109056968 GGCATGAACTCATACATGTAGGG + Intronic
961325962 3:126109520-126109542 GGCAAAAAGTCCCCCATGAGAGG + Intronic
962728176 3:138255016-138255038 GGCAGGCAGACCTACAGGAGAGG + Intronic
965693941 3:171387240-171387262 GAAATGAAGGCCTACTTGAGAGG + Intronic
971895885 4:32593450-32593472 GGCATGAAGCCATTCATGAAGGG - Intergenic
972250458 4:37294415-37294437 AGCATGTAGTCCTACAGGGGCGG - Intronic
974914025 4:68157302-68157324 GCCATGATGTTCTACATAAGTGG + Intergenic
980182924 4:129424040-129424062 GGCATGCTGTCTTAAATGAGTGG - Intergenic
982376711 4:154699044-154699066 GGACTGTAGACCTACATGAGGGG + Intronic
991679212 5:69121874-69121896 GGCATGAATGCTAACATGAGGGG + Exonic
994562863 5:101398494-101398516 GGTATGATTTCCTACATAAGAGG - Intergenic
1000127594 5:158261799-158261821 GAAATAAAGTACTACATGAGAGG + Intergenic
1006422289 6:33942613-33942635 GGCACCAAGACCTTCATGAGGGG - Intergenic
1008290719 6:49712903-49712925 GGGTTGAAGTCCTAGATAAGGGG - Intronic
1011349510 6:86407195-86407217 GCCATGAATTCCTACAGGAGAGG - Intergenic
1011962512 6:93108434-93108456 AGCATGAAGTCTTGCAAGAGTGG - Intergenic
1012190620 6:96275868-96275890 GGCATGAAGTGATACATGCAAGG - Intergenic
1018341501 6:162855964-162855986 GGCATAAAGTCCGGCATGGGTGG - Intronic
1018384728 6:163291928-163291950 GGCATTAAGCCCTACGTGATGGG - Intronic
1027858829 7:83548770-83548792 GGCATGCAGTCATACCTAAGAGG - Intronic
1030536397 7:110772273-110772295 GGCATGAGGTCCCACATCTGTGG + Intronic
1047916227 8:129586870-129586892 GGCATGAGGCACTACAGGAGAGG - Intergenic
1051561454 9:18445943-18445965 GGGATGAATACCTACATGATAGG - Intergenic
1060588437 9:124801173-124801195 GGCTTGAAGTCCAACCTGATAGG - Intronic
1187001713 X:15187516-15187538 TGAATGAAGGGCTACATGAGAGG - Intergenic
1194801634 X:98280699-98280721 GGCCTTAAGGCCTACAAGAGGGG - Intergenic
1196145592 X:112313382-112313404 GGCATGAAGTACCACATCAGAGG - Intergenic
1196761072 X:119201473-119201495 GGCATTAATTCCATCATGAGGGG - Intergenic
1199259726 X:145758213-145758235 GGCATGCAGTCCTATAAGATCGG - Intergenic
1201573740 Y:15440201-15440223 AGCATGATGTTCTACAGGAGTGG + Intergenic