ID: 927970950

View in Genome Browser
Species Human (GRCh38)
Location 2:27306223-27306245
Sequence ATGTCGAAGGTGGAGCTGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927970941_927970950 4 Left 927970941 2:27306196-27306218 CCGTGTGGCCACTGCAGGGTCGG 0: 1
1: 0
2: 0
3: 12
4: 217
Right 927970950 2:27306223-27306245 ATGTCGAAGGTGGAGCTGGCAGG 0: 1
1: 0
2: 1
3: 28
4: 268
927970938_927970950 14 Left 927970938 2:27306186-27306208 CCAGCTGAGTCCGTGTGGCCACT 0: 1
1: 0
2: 0
3: 8
4: 119
Right 927970950 2:27306223-27306245 ATGTCGAAGGTGGAGCTGGCAGG 0: 1
1: 0
2: 1
3: 28
4: 268
927970945_927970950 -4 Left 927970945 2:27306204-27306226 CCACTGCAGGGTCGGGGCCATGT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 927970950 2:27306223-27306245 ATGTCGAAGGTGGAGCTGGCAGG 0: 1
1: 0
2: 1
3: 28
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927970950 Original CRISPR ATGTCGAAGGTGGAGCTGGC AGG Exonic
900749965 1:4389378-4389400 ATGTTGGAGGTGGGGCTTGCTGG + Intergenic
901080151 1:6579628-6579650 GGGTCGAAGGTCGAGCAGGCCGG + Exonic
902029533 1:13411617-13411639 ATTTTGAAGGTATAGCTGGCTGG + Intronic
902064922 1:13677075-13677097 GTGTCGGAGGTAGAGCTGGTGGG - Intergenic
902606216 1:17570805-17570827 ATGTTGAAGGTAGAGCCAGCAGG + Intronic
902854455 1:19190708-19190730 ATTTGGAAGGTACAGCTGGCAGG - Intronic
903066083 1:20700383-20700405 GTTTTGAAGGTGGAGATGGCAGG + Intronic
903260871 1:22131339-22131361 TTGTTGAAGGTGGAGGTGCCTGG + Intronic
905422295 1:37856252-37856274 ATCTGGGAGGTGGAGGTGGCAGG - Intronic
905473759 1:38211629-38211651 AGGTGGAAGGTGGAGCTGTCCGG - Intergenic
907195580 1:52683958-52683980 ATGTTGGAGGTGGAGCTTGGTGG + Intergenic
907243184 1:53091874-53091896 ATGTCGTTGGTGGAGGGGGCAGG - Intronic
907660085 1:56383873-56383895 TTGGGGAAGGTAGAGCTGGCAGG - Intergenic
909133297 1:71766735-71766757 ATGTTGGAGGTGGACCTAGCGGG + Intronic
909381450 1:75003607-75003629 ATGTTGAAGGTGGGGCTTACTGG + Intergenic
909503749 1:76363952-76363974 ATGTGGGAGGTGGGGCTGGTGGG - Intronic
913208644 1:116565005-116565027 GTTTTGAAGGTGGAGCTGGCAGG - Intronic
913216473 1:116624878-116624900 TTGTGGCAGGTGGACCTGGCTGG - Intronic
913301436 1:117374050-117374072 ATGTGGGAGGTGGAGGTGGGAGG + Intronic
913444939 1:118941134-118941156 ATGTCGGAGGTGGTGGTGGGAGG - Intronic
915719077 1:157970882-157970904 ATGTTGAAGGTGGGCCTGGTGGG - Intergenic
917183321 1:172322910-172322932 ATGTTGGAGGAGGAGCTGTCAGG + Intronic
917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG + Intergenic
918127923 1:181600528-181600550 GTTTTGAAGGTGGAGCTGGCAGG + Intronic
918400823 1:184161224-184161246 ATTTTGAAGGTGGAGTTGTCAGG + Intergenic
919619384 1:199847787-199847809 ATTTTGGAGATGGAGCTGGCAGG - Intergenic
919754270 1:201056890-201056912 ATTTTGAAGGTTGAGCTGACAGG - Intronic
920223210 1:204419574-204419596 ATTTTGAAGGTAGAGCTGACAGG - Intergenic
920477145 1:206287087-206287109 ATTTTGAAGGTGGAGCTGATAGG + Intronic
921408365 1:214807431-214807453 ATGTCGATGGTTGACCTGGGCGG - Intergenic
924814090 1:247427397-247427419 AGGTGGAAGGTGGAGAGGGCAGG + Intronic
1062942574 10:1435184-1435206 ACGGGGAAGGTGGTGCTGGCTGG + Intronic
1064236696 10:13582637-13582659 AGGTGGGAGGTTGAGCTGGCTGG - Intergenic
1064286805 10:13998705-13998727 ATCTAGAAGGGAGAGCTGGCAGG - Intronic
1064631672 10:17320550-17320572 CTGGTGAAGGTGGAGATGGCTGG + Exonic
1066537735 10:36409977-36409999 ATGTGGAAGCTTGAGCAGGCTGG + Intergenic
1066644738 10:37594939-37594961 ATGTGGAAGCTCGAGCAGGCTGG + Intergenic
1067314822 10:45151465-45151487 CTGAGGGAGGTGGAGCTGGCTGG + Intergenic
1069944618 10:71977299-71977321 ATGTTGAAGGGGCAGCTGGGAGG - Intronic
1070833362 10:79433545-79433567 TTAGCGAAGGTGGGGCTGGCAGG + Intronic
1071927808 10:90430990-90431012 ATGTCGAAGATGAAGCCTGCAGG - Intergenic
1075470582 10:122686278-122686300 GTGTTGAAGGTGGAGCCTGCTGG - Intergenic
1075744079 10:124714427-124714449 GTGTTGAGGGTGGTGCTGGCAGG - Intronic
1076178986 10:128391273-128391295 ATCTGGAAGGTGGTGTTGGCCGG + Intergenic
1076429240 10:130390075-130390097 AGGCCGTAGGAGGAGCTGGCTGG + Intergenic
1076588811 10:131569445-131569467 ATGTCTAAGGTGGCAATGGCAGG - Intergenic
1077257038 11:1590281-1590303 CTGTGGAAGCTGGAGCTGCCTGG + Intergenic
1077273092 11:1690956-1690978 CTGTGGGAGGTGGGGCTGGCAGG + Intergenic
1078629926 11:12993103-12993125 ATGCTGAGGGTGGACCTGGCAGG - Intergenic
1080174430 11:29344702-29344724 ATGTTGAAGGTGGGGCTGGTGGG + Intergenic
1080971864 11:37287196-37287218 ATCTTGAAGGTGGAGCAGACAGG - Intergenic
1082079170 11:47998842-47998864 ATGTAGGAGGTGCAGCTGCCAGG + Intronic
1083948845 11:65942594-65942616 ATTTCAAAGGTGGAGCTGGTAGG + Intergenic
1086553553 11:88082664-88082686 ATGTTAAAGATGGAGCTTGCAGG - Intergenic
1087329890 11:96767587-96767609 ATGTCGGAGGTGGGCCTGGTGGG + Intergenic
1088567245 11:111184904-111184926 ATGTTGAAGGTAGGCCTGGCAGG + Intergenic
1088810919 11:113391534-113391556 ATTTTGAAGGTGGTGCTGGCAGG + Intronic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1090257996 11:125299266-125299288 GTGTCGGAGGTGGGGCTGGGCGG - Intronic
1091206524 11:133824979-133825001 ATGTCAGAGGTGGAGATGGAAGG + Intergenic
1091358765 11:134958092-134958114 AGGTGGAAGGGGGAGCTGGCTGG - Intergenic
1091668890 12:2438426-2438448 ATGTTGGAGGTGGACATGGCAGG + Intronic
1091785726 12:3242383-3242405 AGGTGGGAGGTGGGGCTGGCTGG - Intronic
1092483662 12:8882933-8882955 AGGCCGAAGATGGAGCTGGCGGG - Intronic
1093239473 12:16652213-16652235 ATGTTGGAGGTGGACCTGGTGGG - Intergenic
1095528619 12:43158089-43158111 ATGTCGAAGGTGGGGCCTGGTGG - Intergenic
1100377365 12:94029831-94029853 ATGTCAAAGGATGAGCAGGCAGG - Intergenic
1101328217 12:103735552-103735574 GTGTGAAATGTGGAGCTGGCAGG + Exonic
1101652800 12:106693085-106693107 CTGCAGAAGGTGGAGCTGACAGG - Intronic
1102524963 12:113505945-113505967 ATGTTCAAGGTCGAGCTGACAGG - Intergenic
1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG + Intergenic
1104765152 12:131325675-131325697 ATGTGTGAGGGGGAGCTGGCAGG - Intergenic
1105992460 13:25636114-25636136 AGGTAGAAGGTGAAACTGGCAGG + Intronic
1108554283 13:51577904-51577926 ACTTCGGAGGTGGAGCTGACAGG + Intergenic
1108883831 13:55155472-55155494 ATGTTGGATGTGGAGCTGGTGGG + Intergenic
1109503278 13:63266787-63266809 ATGTTGGAGGTGGGGCTTGCTGG - Intergenic
1109760911 13:66827569-66827591 ATTTTGAAGGTGGAGTTGGCAGG + Intronic
1112451146 13:99510718-99510740 GTGTTGGAGGTGGAGCTTGCTGG - Intronic
1113408583 13:110063857-110063879 ATGTGTAAGTTGGAGCTGTCTGG + Intergenic
1115082755 14:29477214-29477236 ATGTTGAAGGTGGAGCCTGCTGG - Intergenic
1115648304 14:35385205-35385227 ATGATGAAGGTGGAGAAGGCGGG - Intergenic
1118269499 14:64329323-64329345 ATGTTGAAGGTGGAGCCTGGTGG - Intronic
1118320419 14:64749289-64749311 AAGTAGCAGGTGGGGCTGGCGGG - Exonic
1118737587 14:68713166-68713188 AGAGGGAAGGTGGAGCTGGCTGG - Intronic
1119883767 14:78123059-78123081 ATGTAGAGAGTGGAGGTGGCTGG + Intergenic
1120044521 14:79791051-79791073 ATGTTGGAGGTGGGGCTGGTGGG - Intronic
1120651187 14:87134851-87134873 AGCTTGAAGGTGAAGCTGGCAGG - Intergenic
1120925408 14:89792858-89792880 ATTTCAAAGGTGCAGCTGTCAGG + Intergenic
1121453881 14:94026558-94026580 ATCGCGAAGGGGGAGCGGGCAGG + Intronic
1122315845 14:100825764-100825786 ATGGCCAAGGTGGGGCTGTCGGG - Intergenic
1124157357 15:27237711-27237733 ATGTTGTGGGTGCAGCTGGCAGG - Intronic
1124441612 15:29689667-29689689 AGGCCCCAGGTGGAGCTGGCAGG - Intergenic
1124478533 15:30058183-30058205 AGTTTGAAGGTGGAGCTGGCAGG + Intergenic
1124868948 15:33521683-33521705 GTGTCGAAGGTGGGGCTCCCTGG + Intronic
1129239224 15:74241782-74241804 AGTTTGAAGGTGGAGCTGACAGG + Intronic
1129505106 15:76074876-76074898 ATTTTGAAGGTGGAGCTGGTAGG + Intronic
1131592940 15:93768983-93769005 ATGTTGGAGGTGGGCCTGGCGGG - Intergenic
1134208119 16:12253956-12253978 ATGTGGATGCTGGAGCTGGAAGG + Intronic
1136455189 16:30376295-30376317 AGGCCCAAGGTGGAGCTGACAGG - Intronic
1136925698 16:34371575-34371597 ATGTCTAAGGTCAGGCTGGCTGG + Intergenic
1136978876 16:35040231-35040253 ATGTCTAAGGTCAGGCTGGCTGG - Intergenic
1138991972 16:62401474-62401496 ATGTTGAAGGTGGAGCCGGGTGG + Intergenic
1140556232 16:75924674-75924696 ATGTTGAAGGTGGGGCTTGGTGG + Intergenic
1140970715 16:80009849-80009871 ATGTCTCAGGTTAAGCTGGCTGG - Intergenic
1141376143 16:83532619-83532641 ATGGCGAATGTGGAGCTGATAGG - Intronic
1142189246 16:88710107-88710129 AAGGCCAAGGAGGAGCTGGCGGG - Intronic
1142594301 17:1022179-1022201 ACGTGGAAGGTGGAGCTGTGTGG + Intronic
1144480502 17:15625137-15625159 ATGTTGGAGGTGGAGCTGGGTGG - Intronic
1144917808 17:18738608-18738630 ATGTTGGAGGTGGAGCTGGGTGG + Intergenic
1146320237 17:31841168-31841190 TTATAGAAGGTAGAGCTGGCAGG - Intergenic
1148780016 17:50116039-50116061 AGGCCGATGGTGGGGCTGGCGGG + Exonic
1149608566 17:57942184-57942206 AGCTGGGAGGTGGAGCTGGCTGG + Intronic
1152677659 17:81650056-81650078 CTGTCTAAGGACGAGCTGGCTGG + Intergenic
1152874651 17:82779801-82779823 ACGTGGAAGCTGGAGCTGCCAGG - Intronic
1153966235 18:10184774-10184796 ATGTCGGAGGTGGGGCTTGGTGG + Intergenic
1154496201 18:14963147-14963169 AGGTGGAAGGGGGAGCTGGCTGG + Intergenic
1156418714 18:36927095-36927117 ATGTTGAAGGTGGAGCCTGGTGG - Intronic
1157315781 18:46588684-46588706 ATTTTGAAGGTGGAACTGGCAGG - Intronic
1157438380 18:47690422-47690444 ATGTCCTAGGAGGAGCTGGGTGG - Intergenic
1157946354 18:51984901-51984923 ATGTTGGAGGTGGACCTGGTGGG - Intergenic
1158681240 18:59568932-59568954 AGGACTAAGGTGGAGGTGGCAGG - Intronic
1163015420 19:14451404-14451426 CTGTGGAAGGTGGGGCTGGCTGG - Intronic
1163490082 19:17612383-17612405 ATTTTGAAGGTAGAGCTGGCAGG - Intronic
1164794771 19:31016907-31016929 ATTTCCAAGGAGAAGCTGGCTGG - Intergenic
1164883297 19:31754719-31754741 ATGTTGAAGGTGGAGCCTGATGG - Intergenic
1165191355 19:34066434-34066456 ATGTTGGAGGTGGGGCTGGGTGG + Intergenic
1167461295 19:49625918-49625940 ATGTACAAGGTGGAGGGGGCGGG - Exonic
1168274382 19:55269060-55269082 ATTTTGAAGGTAGAGCTGACAGG - Intronic
925443308 2:3907011-3907033 AGGTTGAGGGTGGAGCTGTCTGG + Intergenic
925549875 2:5061550-5061572 ATGTTGGAGGTGGGGCTGGCTGG - Intergenic
925938457 2:8790772-8790794 ATGCCAGAGGTGGTGCTGGCAGG + Intronic
926951526 2:18248644-18248666 ATGTTGAAGGTGGGGCCTGCTGG - Intronic
927970950 2:27306223-27306245 ATGTCGAAGGTGGAGCTGGCAGG + Exonic
931447124 2:62336124-62336146 ATTTTGAAGGTGGAGCCTGCAGG - Intergenic
932133156 2:69205372-69205394 CTGGAGAAGGTGGAGCTTGCAGG - Intronic
935375917 2:102397374-102397396 ATGTGGGAGGAGGGGCTGGCAGG + Exonic
935629528 2:105201556-105201578 ATGTCGAAGGTGGGCCAGGAGGG + Intergenic
935657864 2:105440160-105440182 ATGTGGAAGGTGTTGATGGCTGG + Intergenic
936286220 2:111183393-111183415 ATGGCAAAGGTGGAGTTGGGAGG - Intergenic
937117646 2:119420105-119420127 GTGTTGAAGGTGGGGCTGGTGGG - Intergenic
937275592 2:120681939-120681961 ATGTCCAAGATGGGTCTGGCTGG - Intergenic
938132186 2:128725974-128725996 ATTTTGAAGGTGGAGGTGACAGG + Intergenic
938303589 2:130232910-130232932 ATTTTGAAGGTAGAGCTTGCAGG - Intergenic
938453088 2:131441350-131441372 ATTTTGAAGGTAGAGCTTGCAGG + Intergenic
938960327 2:136335052-136335074 ATGTTGAAGGTGGAGCCTGGTGG - Intergenic
939170875 2:138693800-138693822 CTGTCATAGGTGGAGCAGGCTGG - Intronic
939503995 2:143021750-143021772 ATGTCGAAGGTGGGGCCTGGTGG - Intronic
939519331 2:143209912-143209934 ATTTCAAATGTGGAGCTGGATGG - Intronic
939985963 2:148830139-148830161 ATGTTGGAGGTGGGGCTGGTGGG + Intergenic
943746049 2:191463711-191463733 ATGTAGAAGGGGTAGCTGGATGG - Intergenic
943781479 2:191829083-191829105 ATGTCCAGGATAGAGCTGGCAGG - Intergenic
946163510 2:217849859-217849881 ATGCCCAAGGTGGTGGTGGCAGG + Intronic
947118742 2:226796916-226796938 GTGTGGAGGGTGGAGCTGTCTGG + Exonic
947403289 2:229749893-229749915 GTGTGGGAGGTGGAGCTTGCTGG + Intergenic
947537142 2:230947292-230947314 ACGTCCAAGGTGCAGCTGGCAGG - Intronic
947830238 2:233134397-233134419 ATGGAGAAGGAGGAGCTGGGAGG + Intronic
947876355 2:233470489-233470511 ATGTCGCTGGAGGTGCTGGCAGG + Exonic
947877909 2:233480127-233480149 AGGTCCCAGGTGGAGGTGGCAGG - Intronic
948662008 2:239513368-239513390 AAGGCGAAGGGGGAGCAGGCAGG - Intergenic
1168809366 20:694163-694185 GTGTCGGAGGTGGGCCTGGCGGG - Intergenic
1169210630 20:3764488-3764510 CTGTCGAAGGTGTGGCTGGGAGG - Intronic
1171959357 20:31482737-31482759 CTGGCGAAGGTGGAGATGCCAGG - Intronic
1172446335 20:34995384-34995406 AAGTCCAAGGTGCAGCTGGAGGG + Exonic
1173271750 20:41542614-41542636 ATCTGGGAGGTGGAGCTTGCAGG + Intronic
1173358304 20:42316242-42316264 ATGTAGAAGGAGGAGCAGACAGG - Intronic
1173382008 20:42553882-42553904 ATTTCTAAGGTGGAGCTGATGGG + Intronic
1173846088 20:46189530-46189552 ATGTCGAAGGTACAGCAGGATGG + Intronic
1174064110 20:47852311-47852333 ATTTTGAAAGTAGAGCTGGCAGG + Intergenic
1174136394 20:48382906-48382928 ATCTTGCAGGTAGAGCTGGCAGG + Intergenic
1174200730 20:48804771-48804793 TTGTCCAAGTTGGAGCTGACAGG + Intronic
1174528949 20:51195791-51195813 ATGTTGGAGGTGGAGCTTGGTGG - Intergenic
1175369989 20:58481726-58481748 AGGCCGAAGCTGGAGCCGGCGGG - Intronic
1175522818 20:59613067-59613089 ATGTTGGAGGTGGGGCTGGGTGG - Intronic
1176676508 21:9783754-9783776 TTTTCAAAGGTTGAGCTGGCAGG + Intergenic
1177030122 21:15972419-15972441 ATGTGGACGGTGCTGCTGGCAGG - Intergenic
1179638891 21:42733891-42733913 ATGTTGGAGGTGGGGCTGGTGGG + Intronic
1181727655 22:24822652-24822674 AGGGCAGAGGTGGAGCTGGCAGG + Intronic
1181861631 22:25823592-25823614 CTGTCGAAGGTGGTGCTTGAAGG - Exonic
1183162388 22:36123529-36123551 ACATGGAAGGTGGAGCTGCCTGG + Intergenic
1183758187 22:39790372-39790394 GTTTCGAAGGTAGAGCTGGTAGG + Intronic
1184141120 22:42577883-42577905 AAGGAGAAGCTGGAGCTGGCTGG - Intergenic
1184626706 22:45739130-45739152 ATGAAGAAGGTGGGGCAGGCAGG + Intronic
1184735578 22:46395793-46395815 TTGTCCAAGGTGGAGCTGCTGGG - Intronic
1184870953 22:47238216-47238238 GTGTGGAAGATGGAGCTGGGTGG - Intergenic
1203236765 22_KI270732v1_random:10302-10324 ATGTCGCAGGTGGGGCTTACTGG - Intergenic
954445283 3:50543003-50543025 AGGGAGAAGGTGGAGCTGGGAGG + Intergenic
955167128 3:56525826-56525848 ATGTTGAAGGTGGGCCTGGTGGG + Intergenic
956093417 3:65691604-65691626 TTGTTTAAGGTGGAGCTGGTGGG - Intronic
956185276 3:66556532-66556554 ATGTTCCAGGTAGAGCTGGCAGG - Intergenic
957248298 3:77739993-77740015 ATGTTGGAGGTGGAGCTTGGTGG - Intergenic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960516035 3:118603895-118603917 ATGTTGGAGGTGGGGCTGGTGGG + Intergenic
961353752 3:126321014-126321036 GTGAGGAAGCTGGAGCTGGCGGG + Intergenic
961460875 3:127049619-127049641 AAGACAAAGGAGGAGCTGGCAGG + Intergenic
961531651 3:127543845-127543867 ATTTTGGAGGTGGAGGTGGCAGG + Intergenic
961867274 3:129962690-129962712 ATGTTGAAAGTACAGCTGGCAGG - Intergenic
964387984 3:156169596-156169618 ATGTTGAAGGTGGAGCGTGATGG + Intronic
964552816 3:157903906-157903928 ATGTTGAAGGTGGGGCTTGTGGG + Intergenic
965074803 3:163962832-163962854 ATGTTGAAGGTGGGGCCTGCTGG + Intergenic
965903664 3:173675364-173675386 ATTTTGAAGATTGAGCTGGCTGG - Intronic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967967747 3:194975325-194975347 ATGAAGAAGGTGGAGCCGACTGG - Intergenic
968882073 4:3306251-3306273 AAGCGGAAGGAGGAGCTGGCTGG + Intronic
969198542 4:5582730-5582752 ATGTTGCAGGTGGAGCTTGGTGG + Intronic
969291175 4:6241134-6241156 AGGCTGGAGGTGGAGCTGGCAGG + Intergenic
971877231 4:32323113-32323135 ATGTTGAAGGTGTGACTGGCTGG - Intergenic
973731950 4:53831438-53831460 ATGTTGGAGGTGGAGCTTGGTGG + Intronic
974787447 4:66637513-66637535 ATGTAGCAGGTGGACCTTGCAGG + Intergenic
975557273 4:75676929-75676951 ATGTCAAAGGAAGAGCTGGCTGG - Intronic
975902548 4:79169827-79169849 ATGTTGAAGGTGGAGCCTGGTGG - Intergenic
978983537 4:114981888-114981910 ATGTTGAAGGTGGGGCTTGGTGG + Intronic
979158521 4:117429244-117429266 GTGGGGAAGGTGGGGCTGGCTGG + Intergenic
981267263 4:142801534-142801556 AAGTCGAAGATGGAGTTGGCAGG - Intronic
981294652 4:143117711-143117733 ATTTTGAAGGTAGAGCTGACAGG + Intergenic
981422829 4:144571023-144571045 ATGTTGAAGATAGAGCTGACAGG + Intergenic
981708210 4:147683485-147683507 ATTTCGAAGGTGAAGACGGCAGG + Intronic
981892503 4:149755059-149755081 ATTTTGAAGGTAGAGCTGACAGG - Intergenic
982338698 4:154270512-154270534 AAGAAGAAGGTGGAGATGGCAGG + Intronic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
985386496 4:189453143-189453165 ATGTTGAAGGTGGAGCCTGGTGG + Intergenic
985399024 4:189575014-189575036 TTTTCAAAGGTTGAGCTGGCAGG - Intergenic
986904891 5:12484775-12484797 ATGTCGGAGGTGGAGCCTGGTGG - Intergenic
990631091 5:57670019-57670041 ATGTCGAGGAGGGAGCTGGTGGG - Intergenic
991945558 5:71895334-71895356 ATGTCTGGGGTGGAGCTGGCAGG + Intergenic
993340777 5:86722761-86722783 ATGTTGGAGGTGGGGCTGGTGGG - Intergenic
995371643 5:111425450-111425472 ATCTTGAAGGAGGAGGTGGCAGG - Intronic
996663174 5:126027642-126027664 CTGGTGGAGGTGGAGCTGGCTGG - Intergenic
998162360 5:139820813-139820835 CTGTCCAAGGTGTAGCAGGCGGG + Intronic
999748547 5:154609808-154609830 CTGCCGCAGGTGGTGCTGGCAGG - Intergenic
1003232567 6:4267846-4267868 ATGAGGAAGGTGGAGATGGTTGG + Intergenic
1003801078 6:9668152-9668174 CTCTGGAAGGTGAAGCTGGCTGG + Intronic
1004342493 6:14819642-14819664 AAGTGGGAGGTAGAGCTGGCTGG - Intergenic
1004470768 6:15927126-15927148 ATGTTGAAGGTAGAGTTGACAGG + Intergenic
1006899241 6:37489565-37489587 ATGTCCAAGGTGGAACAGCCTGG + Intronic
1008998904 6:57690217-57690239 ATGTTGGAGGTGGAGCTCGGTGG - Intergenic
1009432118 6:63575566-63575588 ATGTTGAAGGTGGAAGTGGCAGG - Intronic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1011645656 6:89455535-89455557 ATGTTGGAGGTGGGGCTGGGTGG + Intronic
1011646033 6:89458936-89458958 ATGTCAAATGTGGGGGTGGCAGG - Intronic
1013538856 6:111087885-111087907 AAGGTGGAGGTGGAGCTGGCGGG + Exonic
1013872683 6:114785812-114785834 ATGTAGAAGCTGGACATGGCAGG - Intergenic
1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG + Intergenic
1015389731 6:132668014-132668036 ATGTGGAATTTGGGGCTGGCAGG + Intergenic
1016130337 6:140460577-140460599 ATGTCGTTGGTGGAGGTGGCTGG - Intergenic
1018460543 6:163994668-163994690 CTGAAGAATGTGGAGCTGGCGGG - Intergenic
1019929079 7:4211466-4211488 GTATTGAAGGTGGAGCTGGTGGG + Intronic
1023138443 7:37077160-37077182 ATGGGGCAGATGGAGCTGGCGGG + Intronic
1023410786 7:39887119-39887141 ATGTCCAAGGTGGGGCTGCAGGG + Intergenic
1024022636 7:45385841-45385863 AGGTGGAAGGTTGAGCTGGGAGG + Intergenic
1027488004 7:78786208-78786230 ATTTTGAAGGTACAGCTGGCAGG - Intronic
1027570497 7:79860123-79860145 ATGTTGAAGGTGGAGCCTGGTGG + Intergenic
1028792953 7:94874246-94874268 ATGTGGGAGGTGGAGGTTGCAGG + Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029837135 7:103324692-103324714 AACTCGAAGATGGAGCTGGAAGG + Intronic
1031496436 7:122454806-122454828 GTTTTGAAGGTAGAGCTGGCAGG - Intronic
1032124179 7:129180071-129180093 ATTTTGAAGGTGTAGCTGTCAGG + Intergenic
1032536517 7:132669104-132669126 ATGTTGGAGGTGGGGCTGGTGGG - Intronic
1033013794 7:137650967-137650989 ATGTGGGAGCTGGAGGTGGCTGG + Intronic
1033890791 7:146010881-146010903 ATTCTGAAGGTAGAGCTGGCAGG - Intergenic
1034076214 7:148233811-148233833 ATGTTGAAGGAGGAGCTTGGTGG + Intronic
1034080620 7:148274626-148274648 AAGGTGAAGGTGGAGCAGGCAGG - Intronic
1035046845 7:155973471-155973493 CTGTGGAAGGTGGAGCTGGGAGG + Intergenic
1035518785 8:259497-259519 TGGTAGAAGGGGGAGCTGGCAGG - Intergenic
1037121863 8:15298317-15298339 ATGTTGGAGGTGGAGCTGGCGGG - Intergenic
1037762778 8:21752863-21752885 ATTTTGAAGGTGGAGCTGCCAGG - Intronic
1038671428 8:29586214-29586236 ATGTCAAAGGTGGAGAAGACTGG - Intergenic
1039853534 8:41393137-41393159 ATGTTGGAGGTGGAGCTTGGTGG - Intergenic
1040546477 8:48401842-48401864 ATGTCCTAGGTGGGCCTGGCTGG + Intergenic
1041860567 8:62508350-62508372 ATGTCCAAGGTGGAGGGGGAGGG - Intronic
1042071763 8:64942673-64942695 ATGTCGAAGGTGGGACTTGGTGG - Intergenic
1046065987 8:109197237-109197259 AAGGCAAAGGAGGAGCTGGCAGG + Intergenic
1047310623 8:123688648-123688670 ATGTCCAAGGTGGAGCAAGGGGG - Intronic
1048020794 8:130537301-130537323 ATGCCAAAGGAAGAGCTGGCAGG + Intergenic
1048189596 8:132275870-132275892 ATGTAGAAGGTTGCACTGGCTGG - Intronic
1048516288 8:135114427-135114449 ATGTTGGAGGTGGGGCTGGGGGG + Intergenic
1049564914 8:143333014-143333036 ATGTCTAGGGTGGGGCTGGTAGG + Intronic
1049724595 8:144139802-144139824 GTGCAGAAGGTGGAGGTGGCAGG + Exonic
1051272092 9:15365532-15365554 GTGTCTGAGGTGAAGCTGGCTGG - Intergenic
1052872834 9:33524399-33524421 ATCTCGAATTTGGAGCTGGGTGG + Exonic
1053273255 9:36764862-36764884 ATTTCGGAGGAGGAGGTGGCAGG + Intergenic
1056496643 9:87161854-87161876 ATGTTGGAGGAGGGGCTGGCTGG - Intergenic
1056527465 9:87456671-87456693 ATGTTGGAGGTGGGGCTGGTGGG - Intergenic
1057325586 9:94060822-94060844 ATGTTGAAGGTGGGGCTTGGTGG - Intronic
1057589048 9:96355991-96356013 ATGTTGAAGGTGGAGCCTGGTGG + Intronic
1058645506 9:107128165-107128187 ATGTAGAAGGTAGAGCTAACAGG - Intergenic
1061824662 9:133250591-133250613 AACTCGAAGGTGGAGCGGGGAGG + Intronic
1062251802 9:135601552-135601574 ATGACGAAGGCAGAGCTGGGGGG + Intergenic
1185672623 X:1824807-1824829 ATGTTGGAGGTGGGGCTGGGTGG - Intergenic
1185676881 X:1856390-1856412 ATGTTGGAGGTAGGGCTGGCTGG + Intergenic
1188980405 X:36721923-36721945 ATGTGGAAGGGAGATCTGGCAGG - Intergenic
1189083308 X:37996251-37996273 GTGTGGAAGGGGGATCTGGCAGG - Intronic
1189235498 X:39483934-39483956 ATGTGGTGGCTGGAGCTGGCTGG - Intergenic
1193363050 X:80598571-80598593 AGGTACAAGGAGGAGCTGGCTGG - Intergenic
1196488099 X:116237320-116237342 ACGTGGGAGGTGGAGCTTGCAGG + Intergenic
1198065367 X:133091224-133091246 ATGTCACAAGTGGAGCAGGCTGG + Intronic
1198517103 X:137420643-137420665 ATGTGGGAGGTAGAGTTGGCAGG - Intergenic
1199817865 X:151415247-151415269 ATGTTGATGGTGGGGATGGCTGG - Intergenic
1200214272 X:154360520-154360542 GTGTCGATGGTGAAGCGGGCGGG + Exonic