ID: 927971341

View in Genome Browser
Species Human (GRCh38)
Location 2:27307747-27307769
Sequence GGGGCACGGAACCAGGGTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 292}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927971341_927971352 -2 Left 927971341 2:27307747-27307769 CCGCCACCCTGGTTCCGTGCCCC 0: 1
1: 1
2: 0
3: 34
4: 292
Right 927971352 2:27307768-27307790 CCGGGGCTCCAGCGCAGACTCGG 0: 1
1: 0
2: 2
3: 8
4: 143
927971341_927971358 22 Left 927971341 2:27307747-27307769 CCGCCACCCTGGTTCCGTGCCCC 0: 1
1: 1
2: 0
3: 34
4: 292
Right 927971358 2:27307792-27307814 TCCTGGACCCCGGCCGCCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 201
927971341_927971354 5 Left 927971341 2:27307747-27307769 CCGCCACCCTGGTTCCGTGCCCC 0: 1
1: 1
2: 0
3: 34
4: 292
Right 927971354 2:27307775-27307797 TCCAGCGCAGACTCGGGTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 119
927971341_927971353 -1 Left 927971341 2:27307747-27307769 CCGCCACCCTGGTTCCGTGCCCC 0: 1
1: 1
2: 0
3: 34
4: 292
Right 927971353 2:27307769-27307791 CGGGGCTCCAGCGCAGACTCGGG 0: 1
1: 0
2: 2
3: 7
4: 156
927971341_927971356 12 Left 927971341 2:27307747-27307769 CCGCCACCCTGGTTCCGTGCCCC 0: 1
1: 1
2: 0
3: 34
4: 292
Right 927971356 2:27307782-27307804 CAGACTCGGGTCCTGGACCCCGG 0: 1
1: 0
2: 0
3: 13
4: 163
927971341_927971360 23 Left 927971341 2:27307747-27307769 CCGCCACCCTGGTTCCGTGCCCC 0: 1
1: 1
2: 0
3: 34
4: 292
Right 927971360 2:27307793-27307815 CCTGGACCCCGGCCGCCTCGGGG 0: 1
1: 0
2: 3
3: 30
4: 192
927971341_927971357 21 Left 927971341 2:27307747-27307769 CCGCCACCCTGGTTCCGTGCCCC 0: 1
1: 1
2: 0
3: 34
4: 292
Right 927971357 2:27307791-27307813 GTCCTGGACCCCGGCCGCCTCGG 0: 1
1: 0
2: 1
3: 8
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927971341 Original CRISPR GGGGCACGGAACCAGGGTGG CGG (reversed) Exonic
900207629 1:1438368-1438390 GGGGCCAGGCAGCAGGGTGGGGG + Intronic
900245064 1:1632817-1632839 TGGGCCCGGGACCCGGGTGGGGG - Exonic
900256295 1:1699976-1699998 TGGGCCCGGGACCCGGGTGGGGG - Intronic
900370373 1:2329523-2329545 GGGGCCTGGCCCCAGGGTGGGGG - Intronic
900438098 1:2640998-2641020 GGGGCAGGGAAGCGGGGTGTGGG + Intronic
901003894 1:6162468-6162490 AGGGCTCTGAGCCAGGGTGGAGG + Intronic
901528495 1:9839092-9839114 GGGACACGGAAGCAGGGGTGGGG + Intergenic
903145887 1:21371800-21371822 GGGGCAGAGAACCAGGCTGGGGG + Intergenic
903164200 1:21509451-21509473 GGAGCACGGAGCCAGGATAGCGG - Exonic
903390918 1:22963148-22963170 GGGGCACGGGCTCAGGGTGCCGG + Exonic
904494242 1:30877762-30877784 TGGGCTCGGAACCAGGCAGGAGG + Intronic
907905731 1:58782771-58782793 GGGGCACAGGAACTGGGTGGGGG + Exonic
908450255 1:64247495-64247517 TGGGCAGGGAAGGAGGGTGGAGG + Intronic
910039644 1:82834337-82834359 AGGGCTCTAAACCAGGGTGGTGG - Intergenic
910731294 1:90400074-90400096 GTGGCACTGACCCAGGGAGGAGG + Intergenic
915316110 1:155030011-155030033 GGGGCAGGGCAGCGGGGTGGGGG + Intronic
916651416 1:166838337-166838359 TGGTCAGGGGACCAGGGTGGAGG - Intergenic
919664759 1:200281481-200281503 GTGGGAGGGAACCAGGGGGGAGG - Intergenic
919847387 1:201650389-201650411 GGGCCACGGAACAAGGACGGTGG + Intronic
920443853 1:206000983-206001005 GGGGAAAGGAACCAGGGAGGGGG - Intronic
923251843 1:232185259-232185281 GGGGAACCACACCAGGGTGGTGG + Intergenic
924830471 1:247588829-247588851 GGTGGACTGTACCAGGGTGGTGG - Exonic
1062902441 10:1156359-1156381 GGGACACGGGACCTGGGTGGGGG - Intergenic
1063121822 10:3109898-3109920 GGGGCAGGGAGGCAGGGAGGCGG + Intronic
1064251066 10:13706917-13706939 GGAGCAGGGAGCGAGGGTGGGGG - Intronic
1069821412 10:71230797-71230819 GGGGCAGGGAAGCAGGGAAGTGG + Intronic
1070148950 10:73793760-73793782 GGGGCATGGGAGCAGGTTGGGGG - Intronic
1070736469 10:78866828-78866850 GAAGCACCGACCCAGGGTGGGGG + Intergenic
1073288260 10:102401066-102401088 GGGGCACTTGAACAGGGTGGGGG + Intronic
1073525768 10:104180751-104180773 GGAGCATAGAAACAGGGTGGTGG - Intronic
1074550480 10:114437843-114437865 GGTGGACAGAACCAGGCTGGAGG - Exonic
1075088008 10:119426423-119426445 GGGACTCGGACCCAGGCTGGGGG - Intronic
1075856952 10:125637925-125637947 GGGGCCCGGCAGCAGGGGGGTGG - Intronic
1077035239 11:491276-491298 GGGGCCTGGAACCCGGGTGCTGG + Exonic
1078328701 11:10401343-10401365 GGGACTGGGATCCAGGGTGGAGG - Intronic
1080588284 11:33700360-33700382 GGGGCAGGGGACCAGGGGCGAGG + Exonic
1080874749 11:36265442-36265464 GAGGCAGGGAACCAGTTTGGAGG + Intergenic
1081673019 11:44951932-44951954 TGGGCCAGGAACCGGGGTGGGGG + Intergenic
1081807734 11:45899610-45899632 GGGGCCAGGAACCAAGGCGGTGG - Intronic
1081975916 11:47234708-47234730 GGGACACAGAACCGAGGTGGGGG - Intronic
1083187674 11:61026982-61027004 GGGGAAGGGAGCCAGGGAGGGGG - Intergenic
1085027560 11:73245446-73245468 GGAGGATGGGACCAGGGTGGCGG + Intergenic
1085400414 11:76232581-76232603 GGGGCAGGGAGACAGGGAGGAGG - Intergenic
1087769679 11:102194632-102194654 GGTGAAAGGAACTAGGGTGGTGG + Intronic
1088877352 11:113947041-113947063 GGGGCACAGGAAGAGGGTGGAGG - Intergenic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1089170729 11:116509732-116509754 GAGGGACAGACCCAGGGTGGGGG + Intergenic
1089398717 11:118152489-118152511 GCGGCACGGAATGAGGATGGTGG - Intronic
1090647611 11:128778389-128778411 GGGGCTGGGAAGCAGGGTGGTGG - Intronic
1091085616 11:132719090-132719112 GGGCCCAGGAAGCAGGGTGGAGG + Intronic
1091211249 11:133863593-133863615 GGTGCAGGGACCCTGGGTGGGGG + Intergenic
1092236547 12:6814329-6814351 GGGGAAGGGAACCAGGCAGGAGG - Intronic
1092717906 12:11410584-11410606 GGGGCTAGAAGCCAGGGTGGGGG - Intronic
1092741062 12:11630088-11630110 GGGGCACAGAAGCAGGAAGGAGG - Intergenic
1093945029 12:25098722-25098744 GGAGCAGAGAAACAGGGTGGTGG - Intronic
1097282254 12:57852341-57852363 GGGGCACTGAGCCTGGGAGGCGG + Intergenic
1099043231 12:77682116-77682138 GTGGCAGGGGACCAGGGTGTGGG - Intergenic
1099834161 12:87886436-87886458 AGGGCAAGGAACCAATGTGGGGG + Intergenic
1101874951 12:108591783-108591805 TGGGGACGGAGCCAGGATGGTGG - Exonic
1101902578 12:108801994-108802016 GGGGCAGGGAAGCGGGGTGGGGG + Intronic
1102538437 12:113600176-113600198 GGGAGATGGAACCAGGGTGGGGG - Intergenic
1102552708 12:113703163-113703185 GAGGGACAGAGCCAGGGTGGAGG + Intergenic
1103728843 12:123012835-123012857 CGGGCATGGAAGGAGGGTGGAGG + Intronic
1104454972 12:128903471-128903493 AGGGCACGGATGCAGGGAGGGGG + Intronic
1105302913 13:19151671-19151693 GGGGCTCAGAAGCAGGCTGGAGG + Intergenic
1105813476 13:24013423-24013445 GGGGCAAGGCACAAGGGTGAGGG - Intronic
1106192654 13:27467192-27467214 GTGGAACGAAGCCAGGGTGGGGG + Intergenic
1106516839 13:30464235-30464257 GGTGCTCGGAACCCGGTTGGGGG + Intronic
1107078148 13:36346106-36346128 CGGTCACGGGACAAGGGTGGAGG - Intronic
1107133423 13:36920037-36920059 GGGGCGCCGGACCTGGGTGGGGG - Intronic
1108577772 13:51804154-51804176 GGGGGGCGGGACCAGGGCGGAGG - Intronic
1114714294 14:24808055-24808077 GTGGCAGGCAGCCAGGGTGGAGG + Intergenic
1118105995 14:62660231-62660253 GGGGCACTGCACCAGAGTGTGGG - Intergenic
1119475231 14:74923097-74923119 GGTGCACGGTCCCAGGGTGGAGG + Intronic
1119889743 14:78173916-78173938 GGGGGAAGGAGCCATGGTGGAGG - Intergenic
1121411686 14:93752760-93752782 GGGGCACGCAACCTGGGTTATGG + Intronic
1122790206 14:104181182-104181204 GGGGCAGGGAGCCAGGCTTGGGG + Intergenic
1122837740 14:104438306-104438328 GGGGGACGCAAACAAGGTGGGGG - Intergenic
1122899826 14:104777822-104777844 GGGGCTCGGGACCAGCCTGGTGG + Intronic
1123684432 15:22786939-22786961 GGGGCCCGGGCCCAGGTTGGGGG + Intronic
1124248299 15:28089790-28089812 GGAGCAGGGAAAGAGGGTGGAGG + Intronic
1124630689 15:31335354-31335376 GGGGAACTGAAGCAGTGTGGAGG - Intronic
1124971834 15:34496080-34496102 GGAGTAGGGAACCAGGGCGGAGG - Intergenic
1126348026 15:47717273-47717295 GGGCCGCGGCGCCAGGGTGGGGG + Intronic
1128728738 15:70006560-70006582 GGGGCATGGACGCAGGGAGGTGG - Intergenic
1128728745 15:70006581-70006603 GGGGCATGGACGCAGGGAGGTGG - Intergenic
1128728752 15:70006602-70006624 GGGGCATGGACGCAGGGAGGTGG - Intergenic
1128728759 15:70006623-70006645 GGGGCATGGATGCAGGGAGGTGG - Intergenic
1128728766 15:70006644-70006666 GGGGCATGGATGCAGGGAGGTGG - Intergenic
1128728773 15:70006665-70006687 GGGGCATGGATGCAGGGAGGTGG - Intergenic
1129189946 15:73931317-73931339 GGAGCAAGGGACCAGGGAGGAGG - Intronic
1129826336 15:78637450-78637472 GGGGCAGGGAAGCAGGTGGGAGG + Intronic
1129829578 15:78659876-78659898 GGAGCAGGGAACCAGTGAGGAGG + Intronic
1129952069 15:79600738-79600760 GGGGCTCTGAATCAGGGTTGGGG - Intergenic
1130664990 15:85862008-85862030 GGCACACGGAATCAGTGTGGGGG - Intergenic
1132537452 16:489744-489766 GGCCCAGGGAACCTGGGTGGAGG + Intronic
1132847500 16:2007191-2007213 GGGGGACGGGAGCGGGGTGGGGG + Intronic
1132847519 16:2007258-2007280 GGGGGACGGGAGCAGGGCGGAGG + Intronic
1134835385 16:17356587-17356609 AGGGCAAGGACCCAAGGTGGAGG + Intronic
1136452389 16:30360769-30360791 GGGACACGGAAGCAGGCAGGTGG - Intronic
1137036824 16:35575225-35575247 GGGGCCCTGCACCAGCGTGGAGG - Intergenic
1137084443 16:36102243-36102265 GGGGCAAGGAGCCGGGGCGGAGG + Intergenic
1139369698 16:66459186-66459208 GGGGCAGGAGACCAGGGAGGAGG - Intronic
1139471479 16:67180279-67180301 CGGGGACGGAACCCAGGTGGGGG - Exonic
1140864801 16:79050565-79050587 GGGGCATGGATCCAGAGAGGAGG + Intronic
1141254132 16:82385217-82385239 GGGCCAGTGAACCATGGTGGGGG + Intergenic
1141700113 16:85638632-85638654 GGGGGTGGGAGCCAGGGTGGAGG - Intronic
1142000161 16:87659875-87659897 GGGGGAGGGAACCTGGGAGGGGG - Intronic
1142142448 16:88478680-88478702 GGGGGACGGACCTAGGCTGGGGG + Intronic
1143510741 17:7393956-7393978 GGGGCAGGGGAGCAGGGTGGAGG + Intronic
1144032919 17:11338045-11338067 GAGGCCTGGAACCAGGGTGTAGG + Intronic
1144944967 17:18965173-18965195 GGGGATCGGGCCCAGGGTGGGGG + Intronic
1145846295 17:28041865-28041887 CGGGGACGGAAGCCGGGTGGGGG + Intronic
1146168816 17:30616385-30616407 TGGGCAGGGATCCAGGGTGTAGG + Intergenic
1146170747 17:30631063-30631085 TGGGCAGGGATCCAGGGTGTAGG - Intergenic
1146344194 17:32047082-32047104 TGGGCAGGGATCCAGGGTGTAGG - Intronic
1146941444 17:36846692-36846714 GGGGCAGTGAACTAGGGAGGAGG + Intergenic
1147449596 17:40495954-40495976 GGGGCACAGTACCAGGAGGGGGG - Intronic
1147614935 17:41822148-41822170 GGGGCAGGGGCCCCGGGTGGAGG - Intronic
1147890988 17:43716687-43716709 GGGACACTGAACCTGGGAGGCGG + Intergenic
1149287147 17:55177255-55177277 TGGGCAAGGAACAAGAGTGGAGG + Intergenic
1150231079 17:63550828-63550850 GGGGCTCGGAACCCAGCTGGCGG + Intronic
1150290445 17:63978495-63978517 GGGGAACGGGAGCTGGGTGGAGG - Intergenic
1150636074 17:66914235-66914257 GGGGCAGGGAAGCATGCTGGGGG - Intergenic
1152094257 17:78263852-78263874 GGGGAACCCACCCAGGGTGGAGG - Intergenic
1152562573 17:81085938-81085960 GGGGCATGGAACCAGGCATGTGG - Intronic
1152692001 17:81722522-81722544 AGGGCACAGGCCCAGGGTGGGGG + Intergenic
1156213922 18:34977306-34977328 GGGGCACCGAACCAGAGATGTGG - Intronic
1156355232 18:36334956-36334978 GGGGCACACAGCCAGGGTGCTGG - Intronic
1156530655 18:37811807-37811829 GGGGAAAGGAATGAGGGTGGTGG + Intergenic
1157674980 18:49562137-49562159 GCGGCACGGAGCCCGGGCGGTGG - Exonic
1158310474 18:56152517-56152539 AGGGAAGGGAATCAGGGTGGGGG - Intergenic
1159247593 18:65829639-65829661 GGGGCACGAAAGCAGAGTGCAGG - Intronic
1160207608 18:76848039-76848061 GGGGCACAGAGACAGGGTGGAGG - Intronic
1160563230 18:79771835-79771857 AGAACACGGAATCAGGGTGGAGG + Intergenic
1160749444 19:727097-727119 GGGGCAGGGACCCAGGGTCAGGG + Intronic
1160868402 19:1266313-1266335 GGGGCCCAGAGCCAGGGTGGGGG - Intronic
1161088077 19:2344212-2344234 GGGGCAGGGGAGCAGGGTGATGG - Intronic
1161210261 19:3062126-3062148 AGGGCCCGGATCCGGGGTGGGGG + Intronic
1161285044 19:3464395-3464417 GGGCCAGGGAGCCGGGGTGGGGG - Intronic
1161791454 19:6362353-6362375 GGGTCAGGGAACCAGGAAGGGGG - Intronic
1162379312 19:10322518-10322540 GGGGCGCAGAACCAGGGTGAGGG - Intronic
1162577172 19:11505789-11505811 GAGGCTGGTAACCAGGGTGGGGG - Exonic
1163669134 19:18617400-18617422 TGGCCACGGAACCCGGGAGGTGG - Intronic
1163691749 19:18742224-18742246 GGGGCACAGAACCAGGGGCCAGG - Intronic
1163694928 19:18759366-18759388 GGGGCACCGCCCCAGGGTGGAGG - Intronic
1164400833 19:27901108-27901130 GGAGCACAGATCCAGAGTGGAGG + Intergenic
1165211959 19:34243102-34243124 GGGGCTTTGAACCAGGGTAGAGG - Intergenic
1165385402 19:35507570-35507592 AGGGCAAGGAAGCAGGGTGTCGG + Intronic
1165761798 19:38325972-38325994 GGTGGACAGGACCAGGGTGGGGG + Intronic
1165994146 19:39832909-39832931 GGGGCAAGGAAGCAGTGTAGGGG - Intronic
1166104513 19:40590703-40590725 GGGGCACGGAAGCAGGGTCAGGG - Intronic
1166113857 19:40640777-40640799 GGGGGAAGCAACCAAGGTGGTGG - Intergenic
1167558418 19:50210335-50210357 GGGGCAAAGAAAGAGGGTGGGGG - Intronic
1168282291 19:55312099-55312121 GGGGCACGGAAGGGGGGTGGAGG - Exonic
1168347102 19:55655264-55655286 GCGCCACGGAACCAGGGTTGGGG - Intronic
925959654 2:9003446-9003468 GGGGCCCGGGAGGAGGGTGGGGG - Intronic
927135356 2:20092769-20092791 GGGGGAATGAACCAGAGTGGTGG + Intergenic
927494271 2:23542089-23542111 GAGTCAGGCAACCAGGGTGGTGG + Intronic
927971341 2:27307747-27307769 GGGGCACGGAACCAGGGTGGCGG - Exonic
931429310 2:62196436-62196458 GGGGCCGGGAAGCAGGGAGGCGG - Intronic
932701269 2:73993495-73993517 GGGACACGGAGCCAGTGGGGTGG + Intronic
934478147 2:94606558-94606580 GGGGCACGGCACAAGGTAGGTGG + Intergenic
934525254 2:95047990-95048012 GGGCCAGGGCACCAGGGAGGAGG - Exonic
934606708 2:95700650-95700672 GATCCACGGAGCCAGGGTGGAGG - Intergenic
936540106 2:113342783-113342805 GAGCCACGGAGCCAGGGTGGAGG - Intergenic
938729043 2:134131700-134131722 GGGGCGGGGGACCAGGGTGGGGG - Intronic
939630828 2:144524411-144524433 GGGGACCGGAAACAGGGCGGCGG - Intronic
940001138 2:148967187-148967209 GGGGAACGGAACCAGGCCAGTGG - Intronic
941545622 2:166846974-166846996 GGGGCAAAGAAGCAAGGTGGAGG + Intergenic
942255913 2:174097636-174097658 GAGGCATAGAACCTGGGTGGTGG + Intronic
945797479 2:214382973-214382995 GGGGCATGAAAGTAGGGTGGGGG - Intronic
945938123 2:215923444-215923466 GGGGCGCGGAAACAGGATTGGGG - Intergenic
947228925 2:227866174-227866196 GAGGAACGGCATCAGGGTGGGGG - Intergenic
947732449 2:232438958-232438980 GAGGCACAGACCCAGGGAGGAGG + Intergenic
948198387 2:236112085-236112107 GTGGCAAGGACCCAGGGTGGGGG - Intronic
948850354 2:240702592-240702614 GGGGGAGGTAACCATGGTGGTGG - Intergenic
1169140315 20:3224043-3224065 GCAGCATGGATCCAGGGTGGAGG - Intergenic
1171468945 20:25354364-25354386 GGGGCAGGGAGGCAGGGAGGGGG + Intronic
1172094937 20:32455990-32456012 GTGACACCGAGCCAGGGTGGTGG - Intronic
1172317089 20:33964296-33964318 GGGGCCCGGAAACAAGGAGGAGG + Intergenic
1172479748 20:35264019-35264041 GGGGCAGGGGACGAGGGAGGGGG + Intronic
1172520360 20:35561941-35561963 GGGGGACAGGACCAGGCTGGAGG + Intergenic
1172751007 20:37251290-37251312 GATGCATGGAACCAGGGTGACGG + Intronic
1173023266 20:39285330-39285352 GGGGCATGGAGTGAGGGTGGGGG + Intergenic
1173832413 20:46099717-46099739 GTGGTACGGAACCACGGGGGCGG - Intergenic
1175243424 20:57566637-57566659 GAGGCAGGGAACCATGGTTGGGG + Exonic
1175669623 20:60890756-60890778 GGGTCAGGGAGTCAGGGTGGGGG + Intergenic
1176093921 20:63330970-63330992 GGTGCACAGAGCCAGGGTGGGGG - Intronic
1178052956 21:28768023-28768045 GGAGCAAGGAATCAGGGTGTCGG + Intergenic
1180051816 21:45335132-45335154 GGGGCACAGATCCGGGGAGGGGG - Intergenic
1180051875 21:45335263-45335285 GGGGCACAGATCCAGGGAGGGGG - Intergenic
1180051905 21:45335339-45335361 GGGGCACAGATCCAGGGAGGGGG - Intergenic
1180051920 21:45335376-45335398 GGGGCACAGATCCAGGGAGGGGG - Intergenic
1180831662 22:18909963-18909985 GGGGCACTGAAAGAGAGTGGGGG - Intronic
1181309801 22:21938417-21938439 CGGGCAGGGAGCCAGGGCGGAGG + Intronic
1181387792 22:22558068-22558090 GGGGAAGGGAGACAGGGTGGGGG + Intronic
1181387867 22:22558267-22558289 GGGGAAGGGAGACAGGGTGGGGG + Intronic
1181387929 22:22558413-22558435 GGGGAAGGGAAACAGGGTGGGGG + Intronic
1181511820 22:23392751-23392773 GGGGAGGGGATCCAGGGTGGAGG + Intergenic
1181725638 22:24809041-24809063 AGGGCACAGAACCAGTGTGAGGG + Intronic
1182301747 22:29340863-29340885 GGGACACAGAAGTAGGGTGGAGG + Intronic
1182508149 22:30800269-30800291 GGGGCAGGGACCCAGGGAAGAGG + Intronic
1182718632 22:32379229-32379251 AGGGCACTGACCCAGGCTGGTGG - Intronic
1183742981 22:39678627-39678649 GGGGCAGGAAGCCAGGGTGCTGG + Intronic
1184186394 22:42867946-42867968 GCAGCACTGATCCAGGGTGGTGG + Intronic
1184243975 22:43226725-43226747 GGGGCAAGGACCCGGCGTGGAGG + Intronic
1184275506 22:43407406-43407428 GGGGCAGGGGAGCTGGGTGGAGG + Intergenic
1184300207 22:43554135-43554157 GGGGAAAGGAATCAGGCTGGTGG + Intronic
1185337952 22:50279132-50279154 GGGGCTCGGAGCCGGGCTGGCGG - Intronic
1203281742 22_KI270734v1_random:135234-135256 GGGGCACTGAAAGAGAGTGGGGG - Intergenic
949925595 3:9038599-9038621 GAGGCAGGGCAGCAGGGTGGAGG - Intronic
950053334 3:10008149-10008171 GGGGCACAGCAGCAAGGTGGAGG - Intronic
950304973 3:11910434-11910456 GGGGCACAGCAGCAAGGTGGAGG - Intergenic
950475481 3:13211868-13211890 TGGACACGAAACCAGCGTGGAGG - Intergenic
950490492 3:13301738-13301760 GGGGCACTGGACCAGGCTGGAGG + Intergenic
950505454 3:13391731-13391753 GGGGAGGGGACCCAGGGTGGAGG + Intronic
950569962 3:13793636-13793658 CGGGCAGGGAATCAGGTTGGGGG + Intergenic
950940054 3:16883947-16883969 GGGGCCCGGAACAAGGGTCCCGG - Intronic
951648787 3:24924996-24925018 GGGGCAGGGAACAGTGGTGGTGG - Intergenic
952976268 3:38698978-38699000 AGAGCACAGGACCAGGGTGGAGG - Intronic
953475054 3:43198438-43198460 AGGGCAGGGAACCAGAGAGGAGG + Intergenic
953878954 3:46681770-46681792 GGTGCTCGGGACCAGGCTGGAGG - Intronic
954445092 3:50542168-50542190 AGGGCTCAGCACCAGGGTGGTGG - Intergenic
954699613 3:52444326-52444348 GGGAGACAGGACCAGGGTGGCGG - Intronic
956659605 3:71584188-71584210 GGGGGAGGGATCCAGGGAGGGGG + Intergenic
961164148 3:124751901-124751923 GGGGCAGGGTGGCAGGGTGGCGG - Intergenic
961710290 3:128823272-128823294 TGGGCTCTGAATCAGGGTGGGGG + Intergenic
961787983 3:129358985-129359007 GGGACACGAAACCAGCGTGGAGG + Intergenic
964606487 3:158565628-158565650 GAGGCAGGGAACCCGGGAGGCGG + Intergenic
968044324 3:195615361-195615383 GGGGCACGGAGCGGGGGTGCAGG + Intergenic
968060109 3:195721420-195721442 GGGGCACGGAGCGGGGGTGCAGG + Intronic
968460876 4:724155-724177 GGGGCACGGAGCCCTGGGGGTGG + Intronic
968631990 4:1656575-1656597 GGGGCTCTGAGCCAGGATGGAGG + Intronic
968690599 4:1987889-1987911 GGCTCACGGCACCAGGGTGGGGG + Intronic
969100289 4:4763398-4763420 GAGGCTGGGAACCAGGGGGGTGG - Intergenic
969471714 4:7392973-7392995 GGGCCAGGGAGCCAGGGTGCTGG - Intronic
975738278 4:77403143-77403165 GGGGCATGAAACCTGGATGGAGG + Intronic
976495707 4:85726970-85726992 GGGGCTTGGATCCAAGGTGGGGG + Intronic
977734307 4:100394444-100394466 GGAGAATGGAACCAGGGAGGAGG - Intergenic
980453612 4:133009623-133009645 GGGGAATTGAACCAGGGAGGTGG - Intergenic
980756938 4:137177157-137177179 GGGTCAGGGTACCAGGATGGTGG + Intergenic
983951119 4:173642649-173642671 GAGGGAGGGAACAAGGGTGGGGG + Intergenic
985419057 4:189765126-189765148 GGGGCAGGGAATCAGGGCAGGGG + Intergenic
985720730 5:1487257-1487279 CAGGCACGGACCCAGTGTGGTGG + Intronic
987374218 5:17218574-17218596 GGGGCCGGGACCCAGGGCGGAGG - Intronic
987999321 5:25329999-25330021 GGGGCAGGTTCCCAGGGTGGTGG - Intergenic
990616105 5:57510046-57510068 CGGGGAGGGAACCAGGGTGCTGG + Intergenic
991970149 5:72133048-72133070 GGACCATGGACCCAGGGTGGAGG - Intronic
993116111 5:83722079-83722101 GGGGCCCGCGGCCAGGGTGGAGG + Intergenic
995480371 5:112586629-112586651 GGGACACTGGAGCAGGGTGGGGG + Intergenic
997356078 5:133263854-133263876 GGGGCACGGAGCCTGAGTGGGGG + Intronic
998879945 5:146635592-146635614 GGGCCACCAACCCAGGGTGGAGG - Intronic
1001241689 5:170076130-170076152 GGGGCAGGGAAGCATGCTGGAGG + Intronic
1001304329 5:170560807-170560829 GGCGGGGGGAACCAGGGTGGAGG - Intronic
1001948116 5:175797081-175797103 GCCGCGCGGAACCAGGGCGGAGG - Intronic
1002594251 5:180312007-180312029 GGGGCAGGGAGGCAGGGAGGCGG + Intronic
1002594268 5:180312047-180312069 GGGGCAGGGAGGCAGGGAGGCGG + Intronic
1003098201 6:3157903-3157925 GGGCCCCGGAACCAGGGGGAGGG + Intergenic
1004424400 6:15497691-15497713 GGGGCCCAGACCCAGAGTGGGGG - Intronic
1005709003 6:28485549-28485571 TGGGCAGGGGACCAGGGTAGGGG + Intergenic
1006310892 6:33258669-33258691 GGGGCGCTGAACCTGGGAGGCGG - Intronic
1006428854 6:33982885-33982907 GAGGCATGGGGCCAGGGTGGAGG + Intergenic
1006606338 6:35259991-35260013 GGGGCAGGGACCCTGGGTGGGGG - Intronic
1006642841 6:35497459-35497481 GCGGCTCGGGACTAGGGTGGAGG - Intergenic
1007764440 6:44152518-44152540 GGGGCAGGGAAGGAGGGAGGGGG - Intronic
1010413266 6:75584962-75584984 GGGGCACAGAGTCAGGCTGGTGG + Intergenic
1013138268 6:107304195-107304217 GGGTCACTCAACCAGGGTTGGGG - Intronic
1014578665 6:123107320-123107342 GGGGCTCTGAAGTAGGGTGGGGG - Intergenic
1017097086 6:150813822-150813844 TGGTCAAGGAACTAGGGTGGTGG + Intronic
1017282200 6:152637085-152637107 GGGGCACGGAGCCGGGGAGGGGG - Intronic
1018850636 6:167587968-167587990 GTGACTCGGAACCCGGGTGGGGG + Intergenic
1018940266 6:168304852-168304874 GAGGCAAGGAGCCAGGGTGCCGG + Intronic
1018972855 6:168540551-168540573 GGGGCACGGAGCTAGGAGGGAGG + Intronic
1019536199 7:1530995-1531017 GGGGCGCGGGCCGAGGGTGGCGG + Intronic
1019564254 7:1671717-1671739 GGGGCAGGGACCCAGGGGGCAGG - Intergenic
1020140412 7:5608426-5608448 GGGGCAGGGAGCCAGGGCAGAGG + Intergenic
1022521792 7:31013223-31013245 GGGGCTGTGAAGCAGGGTGGAGG - Intergenic
1023106238 7:36765654-36765676 GAGCCACGGAATAAGGGTGGTGG - Intergenic
1023791773 7:43758614-43758636 GGGGCCCCGAAGCGGGGTGGCGG - Intergenic
1028930237 7:96404815-96404837 TGGGCATGGAACCAGGCTGGAGG + Intergenic
1029409444 7:100399403-100399425 GGGGCACGGACCCAGGTAGGGGG - Intronic
1029413499 7:100429671-100429693 TGCGCGCGCAACCAGGGTGGTGG + Exonic
1029499686 7:100921103-100921125 GGGAAAGGGAACCAGGCTGGTGG - Intergenic
1029708977 7:102289331-102289353 GGGGCAGGGGGCAAGGGTGGAGG + Intronic
1029746283 7:102517407-102517429 GGGGCTGGGAACTAGGGAGGGGG - Intronic
1029764221 7:102616386-102616408 GGGGCTGGGAACTAGGGAGGGGG - Intronic
1032079967 7:128853912-128853934 GGGGTGAGGAAGCAGGGTGGAGG - Intronic
1032482328 7:132256873-132256895 GGGGCACAGGGACAGGGTGGGGG + Intronic
1035224787 7:157427092-157427114 GGGCCCGGGAACGAGGGTGGCGG - Intergenic
1035372119 7:158386344-158386366 GGGGCACGGGAGGAGGGAGGAGG - Intronic
1036417516 8:8564317-8564339 GGGCCACGGAGCCAGGGAGGAGG + Intergenic
1036473362 8:9070885-9070907 CGGGCAGGGAATCATGGTGGTGG + Intronic
1037881051 8:22573657-22573679 GGGGCAGAGGACGAGGGTGGGGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1040942263 8:52845466-52845488 GGGGCTAGGAACCAAAGTGGAGG + Intergenic
1044643902 8:94417241-94417263 GGGGTTAGGAAGCAGGGTGGTGG + Intronic
1049203829 8:141354268-141354290 GGGGCACGTAACACCGGTGGAGG + Intergenic
1049300552 8:141867256-141867278 GGGGCCAGGAATCAGGCTGGGGG + Intergenic
1049439510 8:142602749-142602771 GGGGCAAGGGATGAGGGTGGGGG + Intergenic
1049654768 8:143792681-143792703 GGGGCACGGAAGTGGGGTGGGGG - Intronic
1049745730 8:144262507-144262529 GGGGGAGGGAACCAGGTTGAAGG + Intronic
1049800934 8:144517305-144517327 GGGGCACAGAACTTGGGAGGGGG - Intronic
1051823978 9:21198385-21198407 CAGGCATGGGACCAGGGTGGAGG - Intergenic
1053131021 9:35615818-35615840 GGGGCAGTGAACCAGAGTGGTGG - Intronic
1053144319 9:35702095-35702117 CGGACAGGGAACCAGGGAGGAGG + Intronic
1055563234 9:77542853-77542875 GGGGAAGGGAACTAGGTTGGTGG + Intronic
1055703311 9:78970532-78970554 GGGCCACGGGAGCAGTGTGGAGG - Intergenic
1056379717 9:86046413-86046435 GGTGCACGGCACCTGGGAGGCGG - Intronic
1056711015 9:88991715-88991737 GGGGCGCGGAACCAGGGTGGGGG + Intronic
1057260599 9:93580948-93580970 GGGGCAGGGAGCCAGTGAGGAGG + Intronic
1057995855 9:99821452-99821474 GAGGCACGGAGCCAGGGCGAGGG - Intergenic
1060114522 9:120929455-120929477 CAGGCAGGGGACCAGGGTGGGGG - Intergenic
1060856399 9:126917083-126917105 GGGGCCAGGAACCATGGTGCTGG + Intronic
1061911608 9:133728042-133728064 GGGACCCGGAGCCAGGGAGGAGG + Intronic
1061921271 9:133783782-133783804 GGGGCAGGGAGGCAGGCTGGTGG - Intronic
1062094552 9:134696059-134696081 GGGGCCAGGAACCTGGGGGGCGG - Intronic
1062208979 9:135353057-135353079 GGGGCTTTGAACCAGGCTGGAGG + Intergenic
1062561172 9:137142725-137142747 TGTGCACGCAGCCAGGGTGGTGG + Intronic
1185466624 X:358808-358830 GGGGGGCGGCACCACGGTGGGGG + Intronic
1189477283 X:41365773-41365795 GGGGGCCTCAACCAGGGTGGCGG - Intergenic
1190335554 X:49259612-49259634 GGGGCCCGGAGCCATTGTGGAGG - Intronic
1190983603 X:55480583-55480605 GGAGAACAAAACCAGGGTGGAGG + Intergenic
1191669785 X:63738570-63738592 GGGGCAGGGAAGTGGGGTGGGGG - Intronic
1192201831 X:69071228-69071250 GGGGGAGGGAACCAGGCTGAAGG - Intergenic
1192362317 X:70447607-70447629 GGAGCTGGAAACCAGGGTGGGGG - Intronic
1198807463 X:140505398-140505420 GGGGCACGCAAGCAGATTGGGGG + Exonic
1200247581 X:154534301-154534323 GGGCCGGGGGACCAGGGTGGGGG - Intronic