ID: 927971373

View in Genome Browser
Species Human (GRCh38)
Location 2:27307842-27307864
Sequence CTGTACCAGGAGCAGCAGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 266}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927971361_927971373 20 Left 927971361 2:27307799-27307821 CCCCGGCCGCCTCGGGGCTCCTC 0: 1
1: 0
2: 2
3: 36
4: 309
Right 927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG 0: 1
1: 0
2: 5
3: 17
4: 266
927971365_927971373 14 Left 927971365 2:27307805-27307827 CCGCCTCGGGGCTCCTCTGGCTG 0: 1
1: 0
2: 0
3: 26
4: 271
Right 927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG 0: 1
1: 0
2: 5
3: 17
4: 266
927971366_927971373 11 Left 927971366 2:27307808-27307830 CCTCGGGGCTCCTCTGGCTGCTC 0: 1
1: 1
2: 2
3: 42
4: 374
Right 927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG 0: 1
1: 0
2: 5
3: 17
4: 266
927971362_927971373 19 Left 927971362 2:27307800-27307822 CCCGGCCGCCTCGGGGCTCCTCT 0: 1
1: 0
2: 0
3: 32
4: 276
Right 927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG 0: 1
1: 0
2: 5
3: 17
4: 266
927971359_927971373 26 Left 927971359 2:27307793-27307815 CCTGGACCCCGGCCGCCTCGGGG 0: 1
1: 0
2: 2
3: 23
4: 321
Right 927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG 0: 1
1: 0
2: 5
3: 17
4: 266
927971369_927971373 1 Left 927971369 2:27307818-27307840 CCTCTGGCTGCTCCCAGGGCACA 0: 1
1: 0
2: 3
3: 58
4: 446
Right 927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG 0: 1
1: 0
2: 5
3: 17
4: 266
927971363_927971373 18 Left 927971363 2:27307801-27307823 CCGGCCGCCTCGGGGCTCCTCTG 0: 1
1: 0
2: 3
3: 44
4: 283
Right 927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG 0: 1
1: 0
2: 5
3: 17
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927971373 Original CRISPR CTGTACCAGGAGCAGCAGCG CGG Exonic
901027503 1:6286363-6286385 CTGTAGCAGGTACAGCAGCCAGG + Intronic
901144347 1:7055047-7055069 CTGTCACAAGAGCAGCACCGAGG + Intronic
901443524 1:9293278-9293300 CTCTCCCAGGAGCCGCGGCGAGG - Intronic
901677182 1:10892371-10892393 CTGTCCCAGGAGCAGCAAGGAGG - Intergenic
902338552 1:15767781-15767803 CTGCGGCAGGTGCAGCAGCGAGG - Intronic
902362274 1:15948434-15948456 CTGAACCAGCAGCGGCAGCTGGG - Exonic
902472163 1:16656731-16656753 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
902486640 1:16750715-16750737 CTGGAGGAGGAGCAGCAGGGAGG + Intronic
908824009 1:68116158-68116180 AGGGACCAGGAGCAGCAGCTCGG + Intronic
909537257 1:76751276-76751298 CTGGTACAAGAGCAGCAGCGTGG + Intergenic
910099719 1:83563137-83563159 CTGGTCCAGGAGCAGGAGTGAGG - Intergenic
910238733 1:85063317-85063339 GTGGACCAGGAGCAGCAGGAGGG + Intronic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
914377023 1:147080598-147080620 CTGTGCCAAGAGAAGCAGCAAGG - Intergenic
914474712 1:148013700-148013722 CTGTGCCAAGAGAAGCAGCAAGG + Intergenic
915106953 1:153540717-153540739 CTCAACAAGGAGCAGCAGGGAGG + Intronic
915312338 1:155010952-155010974 CTTCTCCAGGAGCAGCAGCTTGG - Exonic
915317630 1:155038198-155038220 TTGTCCAAGGAGCAGCAACGAGG + Intronic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
917296285 1:173522785-173522807 GTGTTCCAGGAGCAGCACAGAGG - Intronic
917367112 1:174244344-174244366 CTGAAGCAGGAGTAGCAGCATGG + Intronic
919980361 1:202639084-202639106 CTGGCTCAAGAGCAGCAGCGTGG + Intronic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
922536474 1:226384840-226384862 CTGTTCCAAGTGCAACAGCGAGG + Intronic
922674164 1:227540915-227540937 CTGTACCTGGAGCTGCAGGGTGG + Intergenic
1062760433 10:12984-13006 CTGTACCTGGAGCTGCAGGGTGG - Intergenic
1063342245 10:5277184-5277206 CTGTGCTATGAGCTGCAGCGGGG - Intergenic
1064152744 10:12878461-12878483 CGGTACAAGGAGTAGCAGCCTGG + Intergenic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1067466489 10:46502957-46502979 CTGGACCAGGAGCAGGAGCTGGG + Intergenic
1067620699 10:47881648-47881670 CTGGACCAGGAGCAGGAGCTGGG - Intergenic
1070501916 10:77080461-77080483 CTGCATCAGGACCAGCAGCCAGG + Intronic
1070755924 10:78993246-78993268 CTGGACCAGTAGCAGCACCTGGG + Intergenic
1072609172 10:97005084-97005106 CTGTGCCAGGAAGAGCAGCCAGG + Intronic
1074866377 10:117546466-117546488 CTGTACACGGAGCCGCAGGGCGG + Intronic
1075200254 10:120396384-120396406 CTTCACCAGCAGCAGCAGCATGG - Intergenic
1075206952 10:120456819-120456841 CAGGACCAGGAGCTGCAGAGGGG + Intergenic
1075600595 10:123765793-123765815 CTGGAGGAGGAGCAGCAGGGTGG - Intronic
1075799873 10:125146972-125146994 CTGGACCAGGTGCAGCTGGGTGG - Intronic
1076627420 10:131830642-131830664 CTGGAGCAGGCGCAGCAGCACGG - Intergenic
1077919128 11:6630252-6630274 TTCCACCAGCAGCAGCAGCGCGG + Exonic
1079025223 11:16941961-16941983 ATGTACCAGGAGCAACACTGGGG - Intronic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080876367 11:36278644-36278666 CTGTAACAGAAGCAGCAGGCAGG + Intronic
1083160912 11:60853576-60853598 CTCCACCAGGCCCAGCAGCGAGG + Exonic
1083201146 11:61121748-61121770 GTGTGCCGGGAGCAGCAGTGTGG + Exonic
1083256412 11:61498784-61498806 GTGTCCCAGGAGCAGCGGTGGGG - Intergenic
1083541758 11:63516242-63516264 CTGGAACAGGAGCAGCACCTGGG - Exonic
1084427588 11:69094121-69094143 CAGTGCCAGGGGCAGCAGTGGGG + Intergenic
1085314879 11:75538735-75538757 CCTTACCAGTAGCAGCAGCAGGG - Intergenic
1088817018 11:113428385-113428407 CTGTCCCAGGGAAAGCAGCGAGG + Intronic
1089841632 11:121423818-121423840 TTGTTCCTGGAGCAGCAGGGAGG - Intergenic
1090255716 11:125282559-125282581 CTGTACCAGCAGCATCACCTGGG - Intronic
1091727718 12:2857247-2857269 CTGTAACAGGAGCTGCTGCCGGG + Intronic
1091888241 12:4031882-4031904 CGGGTCCAGGAGCAGAAGCGCGG - Intergenic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1094808034 12:34109527-34109549 CTGTACCAGGAGCTGCAGGGTGG - Intergenic
1095712932 12:45309296-45309318 GTGAACCAGGAGCAGCAGCTGGG + Intronic
1098901999 12:76120038-76120060 CAGTACCAGGAGGACCAGTGAGG - Intergenic
1100039612 12:90299006-90299028 CTCTCCCAAGAGCAGCAGAGAGG - Intergenic
1100211118 12:92399537-92399559 GTTTACCAGGAGCAGAAGCCAGG - Intergenic
1100243456 12:92732963-92732985 CACGACCAGCAGCAGCAGCGGGG + Intronic
1102867039 12:116382782-116382804 CTTTCCCAGGAGGAGCAGCAGGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103704974 12:122866551-122866573 CTGAAGCAAGAGCAGCAGCCAGG + Exonic
1104056753 12:125236626-125236648 CTGTCCCAGGGGCAGCAGTGGGG - Intronic
1105494854 13:20921615-20921637 CTGGACCAAGGGCAGCAGTGGGG + Intergenic
1109093127 13:58073324-58073346 CTGTAGCAGGAGGAACAGAGAGG - Intergenic
1115399375 14:32939700-32939722 GTGTGACGGGAGCAGCAGCGAGG + Intronic
1117447202 14:55815641-55815663 CTGCACCAGAGGCTGCAGCGTGG + Intergenic
1117830045 14:59741186-59741208 CTGTTCCAGGAGCAGCTGGAAGG - Intronic
1118517253 14:66544132-66544154 ATGTACCAGGAACAGCAATGAGG - Intronic
1120199116 14:81517500-81517522 TTGTAGCAAGAGCAGCAGCCAGG - Intronic
1120525226 14:85569378-85569400 CCGTACCAGGAGCAGCAGGGAGG + Intronic
1120654990 14:87178892-87178914 GTGTACCAACAGCAGCAGCCTGG - Intergenic
1121964932 14:98295321-98295343 CTTTCCCAGCAGCAGCAGCTGGG - Intergenic
1122556044 14:102580609-102580631 TTGTTCCAGGAGCATCAGGGAGG + Intergenic
1122723676 14:103736387-103736409 CGGCAGCAGGAGCAGCAGCTGGG - Intronic
1122740067 14:103867152-103867174 CTATGCCTGGAGGAGCAGCGAGG + Intergenic
1122977066 14:105175114-105175136 CTGTACCAGTAGAACCACCGCGG + Intronic
1124415988 15:29473704-29473726 CAATACCAGGCACAGCAGCGAGG + Intronic
1124496059 15:30187886-30187908 CTGGCTCAAGAGCAGCAGCGTGG + Intergenic
1124747515 15:32350761-32350783 CTGGCTCAAGAGCAGCAGCGTGG - Intergenic
1125087999 15:35753758-35753780 CAGTACCATGAGAAGCAGAGAGG - Intergenic
1126994226 15:54421471-54421493 CTGGACCAGCAGCATCAGCTAGG + Intronic
1129172352 15:73816057-73816079 CTGTCCCATGAGCAGCAGCCAGG + Intergenic
1129207281 15:74044695-74044717 CTGCACCAGGGGCTGCAGGGAGG - Exonic
1129243967 15:74268723-74268745 GTACACCAGGAGCAGCAGTGTGG - Intronic
1129467275 15:75731141-75731163 CTGGGCCAGGAGCAGAAGAGGGG + Intergenic
1129692959 15:77724096-77724118 TTGCACCCGGAGCAGGAGCGGGG + Intronic
1129719951 15:77872576-77872598 CTGGGCCAGGAGCAGAAGAGGGG - Intergenic
1130103552 15:80912245-80912267 CTGTATCTGGAGCAGCCACGTGG + Intronic
1132668935 16:1094890-1094912 CAGTGCTAGGAGCAGCAGGGCGG + Exonic
1133024485 16:2982037-2982059 CTGTGCATGGAGCAGCAGTGTGG + Intergenic
1133115757 16:3577157-3577179 CTGTCCCTGGAGCAGCATCGAGG - Exonic
1133319107 16:4902147-4902169 GGGACCCAGGAGCAGCAGCGAGG + Intronic
1135246254 16:20859858-20859880 CTGTCCCAGGAGCAGCAGCAAGG - Exonic
1135400967 16:22165980-22166002 CTGTACCTGGACCAGGAGCTGGG + Intergenic
1137505635 16:49051735-49051757 GTGTGCCAGGAGCAGCTGCCAGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138629446 16:58281759-58281781 CTGAACCACGAGCAGCAGAAAGG + Exonic
1139466039 16:67154727-67154749 CTCCACCAGGCGCTGCAGCGTGG + Exonic
1140764731 16:78146392-78146414 TTGGCCCAGAAGCAGCAGCGGGG + Intronic
1141111861 16:81276440-81276462 CTGTGGCAGGAACAGCAGAGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1143722028 17:8819154-8819176 CTGTGACAGGAGCAGCAGGCAGG + Exonic
1143852272 17:9821926-9821948 CTGTGCCAGGACCAGCCGGGAGG - Exonic
1147120125 17:38330835-38330857 CCCTGCCAAGAGCAGCAGCGTGG - Exonic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1148824233 17:50380479-50380501 CTGTACCAGGAGCTGTGGGGAGG - Exonic
1149001525 17:51762547-51762569 TTGGAACAGGAGCAGCTGCGGGG + Intronic
1151390415 17:73783331-73783353 CTGGACCAGCAGCAGCATCTGGG - Intergenic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1152039702 17:77894781-77894803 CTGCGCCAGGAGCAGGAGGGAGG + Intergenic
1152588660 17:81200375-81200397 CGGCACCAGGTGCAGCGGCGCGG - Exonic
1152953341 18:13338-13360 CTGTACCTGGAGCTGCAGGGTGG - Intergenic
1162117775 19:8441988-8442010 CTGTAGGAAGAGCAGCAGGGAGG + Intronic
1163815997 19:19464889-19464911 CTGTTCCAGGAGCAGGGTCGGGG - Intronic
1164695638 19:30241579-30241601 CTGTCTAAGGAGCAGCAGTGTGG + Intronic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165230251 19:34382238-34382260 CTGTGGCAGGCGCAGCAGAGAGG + Intronic
1165815931 19:38642292-38642314 GTCCACCAGGAGCTGCAGCGAGG + Intergenic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167342265 19:48922827-48922849 CTTGGCCCGGAGCAGCAGCGGGG - Exonic
1202704559 1_KI270713v1_random:13525-13547 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG + Intergenic
927497797 2:23562412-23562434 CTGCACCACCGGCAGCAGCGAGG + Exonic
927954295 2:27197824-27197846 CTGGACCAAGGGCAGCAGTGAGG + Intergenic
927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG + Exonic
929756288 2:44768444-44768466 CTGTACCTGCCCCAGCAGCGGGG + Intronic
931983625 2:67720858-67720880 CTATTCCAAGAGCAGCAGCATGG - Intergenic
932892971 2:75611933-75611955 CTGTCCCAGCAGCAGTAGGGAGG - Intergenic
934157084 2:89213337-89213359 CGGCACCAGGAGGAGCAGCTGGG + Intergenic
934210233 2:89969408-89969430 CGGCACCAGGAGGAGCAGCTGGG - Intergenic
934478061 2:94605971-94605993 ATGACCCAGGAGCAGCAGCCAGG + Intergenic
934767035 2:96885456-96885478 CAGTACCACGAGCAGGAGCCAGG - Intronic
935288428 2:101587801-101587823 GTGTACCCAGAGCAGCAGCTCGG + Intergenic
936074029 2:109390372-109390394 AAGTACCAGGAGCAGCAGAACGG - Intronic
936344284 2:111663311-111663333 CTCTCCCAGAACCAGCAGCGAGG + Intergenic
937952739 2:127401122-127401144 CTGCACCAGGAGCCGCTGGGAGG + Intergenic
941071178 2:160956277-160956299 TTGCACCAGGTGCAGCATCGTGG + Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
945144009 2:206716818-206716840 CTCTACCAAGAGCAGCATCTGGG - Intronic
945208198 2:207354858-207354880 CTGTACCAGGAGAAGAAACATGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947281411 2:228460024-228460046 TTGTGCCAGTAGCAGCAGCATGG + Intergenic
948372064 2:237495754-237495776 CTGTACCAGGGCCAGCAGGTTGG - Intronic
1169118586 20:3082681-3082703 CTGCACCAGCCGCAGCAGCAAGG + Exonic
1170664887 20:18378290-18378312 CAGGACCAGAAGCAGCAGCGAGG + Intergenic
1171123070 20:22582274-22582296 CCGTGCCAGGAGCACAAGCGAGG - Exonic
1172189265 20:33052139-33052161 GTGTTCCAGGAACAGCAGGGGGG - Intergenic
1172581450 20:36051588-36051610 CTGTTCCAGGAACAGCAAAGAGG + Intergenic
1173281458 20:41631914-41631936 CTGGACCAGCAGCAGCATCTAGG + Intergenic
1174568796 20:51486328-51486350 TTGTTCCAGGAGCAGCAAGGAGG - Intronic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175440822 20:58989915-58989937 CTGGCCCAGGAGGAGCAGGGGGG + Exonic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1179422266 21:41245996-41246018 CTGGGGCAGGCGCAGCAGCGTGG - Exonic
1179476792 21:41651631-41651653 CATTGCCAGGAGCAGCAGCCAGG - Intergenic
1180699466 22:17773796-17773818 GTTTCCCAGCAGCAGCAGCGAGG + Exonic
1181311301 22:21946307-21946329 TGGTGCCAGGAGCAGCAGCTGGG + Intronic
1181343975 22:22203666-22203688 CTGCACCAGGAGCTGCGGAGCGG + Intergenic
1181403787 22:22667713-22667735 ATGTAGCAGGAGCAGCACCATGG + Intergenic
1181621398 22:24093966-24093988 CTATCTCAGGAGCAGCAGCTTGG + Intronic
1182164884 22:28163148-28163170 CAATACCATGAGCAGCAGCTGGG - Exonic
1182667832 22:31972255-31972277 CTGTCCCTGGAGCAGAAGAGTGG + Intergenic
1183195582 22:36351461-36351483 CTATACCAGGAGCAGCCTCCAGG + Intronic
1184037620 22:41926201-41926223 CAGTGCCAGGCCCAGCAGCGCGG + Exonic
1184677445 22:46051385-46051407 CTGTCCCATGAGCAGGAGGGTGG + Exonic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1184973058 22:48041190-48041212 CTGTCCCAGCAGCAGAAGAGGGG - Intergenic
1185048903 22:48543510-48543532 GGGTTCCATGAGCAGCAGCGAGG - Intronic
949847120 3:8383039-8383061 CTGTAGCAGGAGTGGCAGAGAGG + Intergenic
950146713 3:10655325-10655347 CTGCACCAAGAACAGCAGCTTGG + Intronic
950674469 3:14546232-14546254 GGGTACCAGGAGCAGCTGAGGGG + Intergenic
951757580 3:26108424-26108446 CTATTCCAGGAGCAGGAGAGGGG - Intergenic
954144572 3:48628174-48628196 CTGTTCCAGGAGCTTCAGCCTGG - Intronic
955364336 3:58298581-58298603 CCATACCAGGAGCTGCAGCAGGG + Intergenic
955461566 3:59189393-59189415 CTGTTCCAGGGGAGGCAGCGGGG + Intergenic
956308865 3:67856934-67856956 ATGGACCAGCAGCAGCAGCATGG + Intergenic
958729937 3:97950780-97950802 CCTTACCAGGAGCAGCTGCCGGG + Exonic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960916588 3:122701523-122701545 GTTTACCACCAGCAGCAGCGGGG + Exonic
961338939 3:126204392-126204414 CTATACCAAGAGCAACAGTGGGG + Intergenic
961385508 3:126521364-126521386 CTGTCCCAGGAATAGCAGGGAGG - Intergenic
961453970 3:127015304-127015326 CCGTACCAGGAGAAGGAGCAGGG - Exonic
964202051 3:154128597-154128619 ATGTACCAAGAGCAGCAAGGAGG - Intronic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
966886517 3:184380344-184380366 CAGCCCGAGGAGCAGCAGCGGGG - Exonic
969021164 4:4141444-4141466 GTGTGCCAGGAGCAGCCGGGTGG + Intergenic
969098492 4:4751790-4751812 CTGTAGCAGGAACAGCGGCAAGG - Intergenic
969246125 4:5934029-5934051 CTAAAACTGGAGCAGCAGCGTGG + Intronic
969692561 4:8711621-8711643 CTGTCCCTGAAGCAGCAGTGTGG - Intergenic
969995978 4:11313687-11313709 CTGTTCTAGGAGCAGGAGTGCGG + Intergenic
975576401 4:75867406-75867428 CTGTCCCAGGATTAGCAGAGTGG - Exonic
976771478 4:88657884-88657906 ATGTGCCAGGGGCAGCAGAGGGG + Intronic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
981483399 4:145260162-145260184 CTGGAGCTGGAGCAGCAGGGAGG + Intergenic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
984964508 4:185128498-185128520 CTGTTCCCGGAGGAGCTGCGAGG + Intergenic
985067217 4:186134387-186134409 CTGTACTAGGTGCCGCAGCAAGG + Intronic
985830327 5:2223399-2223421 CTGAACCTGGGGCCGCAGCGAGG - Intergenic
987075755 5:14380360-14380382 CTGGACCTGGTGCAGGAGCGAGG - Intronic
988734588 5:34007835-34007857 CTGGACCTGAAGCAGCCGCGGGG - Exonic
989352552 5:40502760-40502782 CTGTGCCAGGAGCAGAAACTAGG + Intergenic
989686299 5:44091505-44091527 TTGTTCTAGGAGCAGCAGCTGGG + Intergenic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
997114070 5:131106819-131106841 GTGTACCAGGGGCTGCAGGGAGG + Intergenic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
997975743 5:138440416-138440438 CTGTACTTGGATCACCAGCGGGG + Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998483974 5:142485796-142485818 CTGGGCCAGGTGCAGCAGGGAGG - Intergenic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1002097750 5:176841453-176841475 CTGTCCCATGTGCAGCAGTGTGG + Intronic
1002390726 5:178909679-178909701 CTGTCCCAGGAGCAGCAGCAAGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1003289983 6:4772255-4772277 CTGGCCAAGGAGCAGCAGTGTGG + Intronic
1004845666 6:19639058-19639080 CTGTGCCAGGAGCCGCTGGGTGG - Intergenic
1007654838 6:43445762-43445784 CGGCAGCAGGAGCAGCAGCCAGG - Exonic
1008698774 6:54073691-54073713 CTGTTTCAGGATCAGCAGCATGG - Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008870113 6:56262813-56262835 CTGTAGCAGCATCAGCAGCCTGG + Intronic
1010062276 6:71636530-71636552 CTGGAGCAGGAGCAGCTGTGTGG - Intergenic
1010143749 6:72641998-72642020 CTGAATCAGGACCATCAGCGTGG - Intronic
1011702907 6:89972098-89972120 GTGTGGCAGGAGCAGCAGCTGGG + Intronic
1012914726 6:105157192-105157214 CTGTTCCAGGAGCAGCTGGAAGG - Intergenic
1016797987 6:148138187-148138209 CTGTACCAGGCCGAGCAGCTGGG - Intergenic
1016935596 6:149447132-149447154 CTTTTCCAGGAGAAGCAGTGAGG - Intergenic
1016936137 6:149450722-149450744 CTGTACCAGGAGGATGAGCCTGG + Exonic
1017329723 6:153182236-153182258 CTGTACAATGAGCATCAGAGTGG + Intergenic
1017818842 6:158034430-158034452 CTCTCCCAGCAGCGGCAGCGAGG - Intronic
1019742009 7:2679763-2679785 CTCTGCCTGGAGCAGCAGCCTGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021840485 7:24718114-24718136 CTGTGGCAGGAGCACCAGCAGGG + Intronic
1021904580 7:25320584-25320606 CTGTTCAAGGAGCACCAGGGAGG + Intergenic
1022544920 7:31177539-31177561 CTGTACCTGGAGCAGTAGCTGGG + Intergenic
1025158338 7:56630545-56630567 CTGTACCTGAAGCTGCAGGGTGG - Intergenic
1027192152 7:76002965-76002987 CTGTACCAGGGGCTGGAGCATGG - Intronic
1029489331 7:100861795-100861817 CCCCACCAGGAGCAGCAGCTGGG - Exonic
1032904956 7:136353874-136353896 CTGTACCAGGGGTGGCAGCAGGG + Intergenic
1033244221 7:139704858-139704880 CTGGGCCAGAAGCAGCAGCCTGG + Intronic
1033908572 7:146237149-146237171 CTGTACCAGAAGCAGGACCTTGG + Intronic
1034656742 7:152735829-152735851 CTGTCCCAGCATCTGCAGCGTGG + Intergenic
1035049447 7:155990214-155990236 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049463 7:155990271-155990293 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049471 7:155990300-155990322 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049479 7:155990329-155990351 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049487 7:155990358-155990380 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049495 7:155990387-155990409 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049796 7:155992211-155992233 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1037937983 8:22928051-22928073 CTGGACAAGGAGCTGCACCGAGG - Intronic
1038425203 8:27460244-27460266 CGATCCCAGGAGCAGCAGCTCGG + Exonic
1039718346 8:40134957-40134979 CTGTACCATGAGCAGCTGCGAGG - Intergenic
1041846585 8:62336082-62336104 TTGTACAAGTAGCAGCAGCCTGG + Intronic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045713283 8:105011493-105011515 CTGTAGCTGGAGCTGCAGCCTGG - Intronic
1046932262 8:119853706-119853728 GGGTACCATGAGCAGCAGCTTGG - Intronic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1049097815 8:140559117-140559139 CAGGACTAGAAGCAGCAGCGTGG - Intronic
1049105334 8:140609062-140609084 CTGTGCCAGGGGCCTCAGCGGGG + Intronic
1049681550 8:143920813-143920835 CTCTACCAGCAGCTGCAGCGAGG - Exonic
1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG + Intergenic
1052851888 9:33383602-33383624 ATGACCCAGGAGCAGCAGCCGGG - Intergenic
1053679994 9:40480137-40480159 ATGACCCAGGAGCAGCAGCCGGG - Intergenic
1053929990 9:43108447-43108469 ATGACCCAGGAGCAGCAGCCGGG - Intergenic
1054283718 9:63144798-63144820 ATGACCCAGGAGCAGCAGCCGGG + Intergenic
1054293075 9:63315647-63315669 ATGACCCAGGAGCAGCAGCCGGG - Intergenic
1054391101 9:64620140-64620162 ATGACCCAGGAGCAGCAGCCGGG - Intergenic
1054504627 9:65896186-65896208 ATGACCCAGGAGCAGCAGCCGGG + Intergenic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1059414984 9:114156730-114156752 CTCTCCCAGGAGCGGCTGCGCGG + Intronic
1059875269 9:118627821-118627843 CTGAGTCAGGAGCAGCAGCTGGG - Intergenic
1060361277 9:122959846-122959868 CTGTCCCAGGAGCAGGGGCTGGG - Intronic
1061150423 9:128824976-128824998 CTGAACCAGCAGCAGCACCCAGG - Exonic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062372611 9:136247804-136247826 CTCCAGAAGGAGCAGCAGCGAGG + Intergenic
1062377175 9:136267440-136267462 CTCTCGCAGGCGCAGCAGCGCGG + Intergenic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062523299 9:136968527-136968549 CTGTGTCAGGAGCTGCAGCCAGG - Intergenic
1062533794 9:137012885-137012907 CCGTACCAGGCGCGGCAGGGAGG + Exonic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1190969129 X:55331964-55331986 CTGGACCAGGAGCATCACCTGGG - Intergenic
1195127415 X:101822281-101822303 CTGGGCCAGGAGCAGCAAAGCGG - Intergenic
1199612713 X:149631682-149631704 CAGTAGCGGGAGCAGCAGCGTGG - Exonic
1199846476 X:151695471-151695493 CTGGAAGAGGCGCAGCAGCGAGG + Intronic