ID: 927971923

View in Genome Browser
Species Human (GRCh38)
Location 2:27311200-27311222
Sequence GGCACATGTTACCATGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 154}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927971913_927971923 10 Left 927971913 2:27311167-27311189 CCCACCTCAGCCTCCCGAGTAGC 0: 6037
1: 125141
2: 279269
3: 199503
4: 138471
Right 927971923 2:27311200-27311222 GGCACATGTTACCATGTGACTGG 0: 1
1: 0
2: 3
3: 13
4: 154
927971921_927971923 -3 Left 927971921 2:27311180-27311202 CCCGAGTAGCTGGGACTACGGGC 0: 658
1: 74396
2: 194685
3: 239583
4: 180074
Right 927971923 2:27311200-27311222 GGCACATGTTACCATGTGACTGG 0: 1
1: 0
2: 3
3: 13
4: 154
927971912_927971923 13 Left 927971912 2:27311164-27311186 CCTCCCACCTCAGCCTCCCGAGT 0: 2427
1: 22969
2: 41666
3: 78900
4: 130303
Right 927971923 2:27311200-27311222 GGCACATGTTACCATGTGACTGG 0: 1
1: 0
2: 3
3: 13
4: 154
927971918_927971923 0 Left 927971918 2:27311177-27311199 CCTCCCGAGTAGCTGGGACTACG 0: 532
1: 56811
2: 180054
3: 270725
4: 192800
Right 927971923 2:27311200-27311222 GGCACATGTTACCATGTGACTGG 0: 1
1: 0
2: 3
3: 13
4: 154
927971922_927971923 -4 Left 927971922 2:27311181-27311203 CCGAGTAGCTGGGACTACGGGCA 0: 339
1: 33444
2: 133954
3: 148498
4: 127581
Right 927971923 2:27311200-27311222 GGCACATGTTACCATGTGACTGG 0: 1
1: 0
2: 3
3: 13
4: 154
927971916_927971923 6 Left 927971916 2:27311171-27311193 CCTCAGCCTCCCGAGTAGCTGGG 0: 97626
1: 275854
2: 227041
3: 130261
4: 162635
Right 927971923 2:27311200-27311222 GGCACATGTTACCATGTGACTGG 0: 1
1: 0
2: 3
3: 13
4: 154
927971914_927971923 9 Left 927971914 2:27311168-27311190 CCACCTCAGCCTCCCGAGTAGCT 0: 6083
1: 36071
2: 47989
3: 39959
4: 95342
Right 927971923 2:27311200-27311222 GGCACATGTTACCATGTGACTGG 0: 1
1: 0
2: 3
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927971923 Original CRISPR GGCACATGTTACCATGTGAC TGG Intronic
904091267 1:27946597-27946619 GGCACATGATCCCATCTGGCAGG + Intronic
904257790 1:29267381-29267403 GGCACTTATCACCATCTGACAGG - Intronic
905808603 1:40895229-40895251 GGCACATCTTACATGGTGACAGG + Intergenic
907180057 1:52561653-52561675 GGCACATGCCACTATGTGCCTGG - Intergenic
909073299 1:71022990-71023012 TGGACATGTTAAAATGTGACTGG - Intronic
912680282 1:111725038-111725060 GAAACATCTTACCATTTGACTGG + Exonic
913076368 1:115343625-115343647 TCAACATGATACCATGTGACAGG - Intergenic
917331908 1:173889384-173889406 TGCACGTGTTACCTTGTGAAGGG + Exonic
921791100 1:219291747-219291769 GGCATTTGTAACCCTGTGACAGG - Intergenic
1063819149 10:9814182-9814204 GGCACATCGTTCCATGTAACTGG - Intergenic
1064533613 10:16335171-16335193 GGCAGAGGTTGCCATGTGCCAGG + Intergenic
1067715164 10:48685109-48685131 GGCACATGTGACCCAGTGCCTGG + Intronic
1068374931 10:56165696-56165718 GGCACATCTTACATGGTGACAGG - Intergenic
1075255525 10:120923572-120923594 GGCCCATGTTGCCATGGGAATGG + Intergenic
1080993891 11:37577548-37577570 GGCACATCTTACATGGTGACAGG - Intergenic
1081253441 11:40863443-40863465 GGCCCATGATATCATGAGACAGG - Intronic
1081414740 11:42800906-42800928 GGCACATCTTACAAGGTGGCAGG + Intergenic
1087511458 11:99101080-99101102 GGCACATGTTACATGGTGGCAGG + Intronic
1087831912 11:102827517-102827539 GGCACATGTTACATGGTGGCAGG + Intergenic
1088151087 11:106746242-106746264 GCCATATATTACCATGTGACTGG + Intronic
1088576582 11:111277919-111277941 GGCACATATTCCCATGTAGCAGG - Intronic
1090304572 11:125680011-125680033 GACTCGTGTCACCATGTGACTGG + Intronic
1090975433 11:131676038-131676060 GGTCCATGTCACCATGGGACTGG + Intronic
1091900543 12:4140849-4140871 GACGCATGTTTCCAGGTGACAGG + Intergenic
1093268693 12:17030351-17030373 TGCTCATGTGACCATGTTACTGG + Intergenic
1094245232 12:28283798-28283820 TGCACTTGATCCCATGTGACAGG - Intronic
1096339346 12:50784298-50784320 GGCACATATTACCAACTGATAGG - Intronic
1097989181 12:65817112-65817134 GGCAAAAGTTATAATGTGACTGG - Intergenic
1098214619 12:68202552-68202574 GGCACATCTTACCTGGTGGCAGG + Intronic
1100747618 12:97662731-97662753 GGCACATCTTACATGGTGACAGG + Intergenic
1101236193 12:102792674-102792696 GGCTCATGTGACCTTGTGAAGGG - Intergenic
1105732499 13:23232397-23232419 GGGACATTTTACGTTGTGACAGG - Intronic
1108825037 13:54403131-54403153 GGCTCATGTTACCATTTGTAAGG + Intergenic
1109735147 13:66473560-66473582 GACTCATGTTACAATGTAACTGG + Intronic
1111742832 13:92226113-92226135 GGCACATATTACTTTGTGGCAGG - Intronic
1113632332 13:111896826-111896848 GGCACATCTCACCCTGTGGCAGG + Intergenic
1113682129 13:112251779-112251801 GGCACCTGAGACCATGTGTCAGG - Intergenic
1113892207 13:113742398-113742420 GGCCTCTGTCACCATGTGACCGG - Intergenic
1116186466 14:41606257-41606279 GTCACATTTTACTATGTGAAGGG - Intergenic
1117221642 14:53612169-53612191 GTCAGATGTGTCCATGTGACAGG - Intergenic
1121450327 14:94002961-94002983 GGCACATCTTACCTGGTGGCAGG + Intergenic
1123903319 15:24897771-24897793 GGCACATGTTACATGGTGGCAGG - Intronic
1125127046 15:36236722-36236744 GGCACATCTTACATGGTGACAGG + Intergenic
1125383437 15:39112096-39112118 GGCACATCTTACCAGGTGGCAGG + Intergenic
1126988694 15:54345105-54345127 TGCACATGTCACCATGTGACTGG + Intronic
1129900189 15:79141826-79141848 GGCACATCTTACATTGTGGCAGG + Intergenic
1131783285 15:95883242-95883264 GGAAGATGAAACCATGTGACAGG - Intergenic
1133384089 16:5354835-5354857 GCCACTTGTCACCATGTGCCAGG + Intergenic
1133502991 16:6383074-6383096 AGCACATGTCAGCAAGTGACTGG - Intronic
1136546001 16:30955066-30955088 GGCCCTTGTTAGCATCTGACAGG - Intronic
1138629054 16:58279092-58279114 TGAATATGGTACCATGTGACAGG + Intronic
1144240880 17:13310301-13310323 GGCAAATGTTTCCATGGGAGAGG + Intergenic
1144930653 17:18856293-18856315 GTCACATGTTGGCATGTGACTGG - Intronic
1147336588 17:39730068-39730090 CGGACATTTTACCATGTGCCAGG + Intronic
1150459174 17:65332933-65332955 GGCACATCTTACAAGGTGGCAGG + Intergenic
1151543749 17:74779234-74779256 GGCACATGCTGACATGTGAGAGG - Intronic
1154162653 18:11991465-11991487 GCCACATGACACCATGTGATAGG + Intronic
1155120926 18:22817699-22817721 GCCACATGTTACCACATGTCTGG - Intronic
1156185734 18:34660939-34660961 GGCACATGTTCTCAGGAGACAGG + Intronic
1159122793 18:64190289-64190311 GGCACATCTTACCTGGTGGCAGG + Intergenic
1159184720 18:64954510-64954532 TGCACCTGTTTCCATGTGATTGG - Intergenic
1163053484 19:14702098-14702120 AGCACTTTTTCCCATGTGACAGG - Intronic
1163478788 19:17542408-17542430 GGCTCATGTCCCCATGAGACTGG - Intronic
1164247804 19:23448782-23448804 TGGACATGTTACCAGGAGACTGG + Intergenic
1166624492 19:44338086-44338108 GGGACATGTTACAAGGTCACAGG + Intronic
925747510 2:7056288-7056310 GGCACATCTTACCATGGGTGTGG - Intronic
926775420 2:16417581-16417603 GGAACATGTTACCTTATGTCTGG + Intergenic
927971923 2:27311200-27311222 GGCACATGTTACCATGTGACTGG + Intronic
928520105 2:32080330-32080352 GGTCAATCTTACCATGTGACAGG - Intronic
930702757 2:54475570-54475592 GCCTCCTGCTACCATGTGACAGG + Intronic
930717353 2:54605274-54605296 GGTACATGCTTCCATGTGAAAGG - Intronic
936226379 2:110657435-110657457 GGCTCATTTGACCATGTGATTGG + Intronic
936850929 2:116896675-116896697 GGCACATCTTACATGGTGACAGG + Intergenic
936976741 2:118228437-118228459 GGCATATGTTGACATGTGGCAGG - Intergenic
937396708 2:121543247-121543269 CCCACATGTTATCAAGTGACTGG - Intronic
937688617 2:124726418-124726440 GGCACATCTTACATGGTGACAGG - Intronic
938394297 2:130931049-130931071 GGCCCATGTCACCATGTCAGTGG - Exonic
939141199 2:138356728-138356750 GGCAGCACTTACCATGTGACGGG - Intergenic
939319856 2:140604896-140604918 GGCACATCTTACATGGTGACAGG - Intronic
942822729 2:180135157-180135179 GGCACTTGTTACTATGTCATTGG + Intergenic
942965056 2:181882389-181882411 GGCAGATGTAATCATCTGACAGG + Intergenic
946709715 2:222493293-222493315 GGCACATCTTACAAGGTGGCAGG + Intronic
1168830700 20:843929-843951 GGCTGATGTTTCCACGTGACAGG + Intronic
1175663291 20:60836238-60836260 GGCACTTGAAGCCATGTGACTGG - Intergenic
1178198676 21:30378296-30378318 GGCACATGTTACATGGTGGCAGG - Intronic
1178261725 21:31106210-31106232 GGCACATCTTACACGGTGACAGG + Intergenic
1178421104 21:32443988-32444010 AGCACATGTTTCTATGAGACAGG + Intronic
1179052824 21:37903331-37903353 GGCACATCTTACATGGTGACAGG - Intronic
1183381028 22:37490633-37490655 GGCACAGGTGACCATGGGCCAGG + Exonic
1185005422 22:48273707-48273729 ACCACCTGTTACCATGTGAGGGG + Intergenic
949399117 3:3647057-3647079 GGGAGAAGATACCATGTGACTGG - Intergenic
953433039 3:42855234-42855256 GGCACATGGTACCTTGTCCCTGG - Intronic
953433040 3:42855237-42855259 GGGACAAGGTACCATGTGCCTGG + Intronic
954306140 3:49726472-49726494 GGCACCTGTTGGCACGTGACAGG - Exonic
954719917 3:52552825-52552847 GGTAAATGTTCCCATGTGGCAGG - Intronic
954744094 3:52777269-52777291 GCCACATGTCACCGTGTCACTGG + Intergenic
959016030 3:101134926-101134948 GGCACATTTTGCCATGAGACAGG + Intergenic
959917736 3:111836733-111836755 GGCACATCTTACATGGTGACAGG + Intronic
961362980 3:126379821-126379843 GGCACATGCCACCATGCAACTGG - Intergenic
963641518 3:147866118-147866140 TGCACATTTTACCATATGTCTGG + Intergenic
965064366 3:163827644-163827666 GGAATTTGTTACCATGAGACTGG - Intergenic
965189291 3:165507391-165507413 GGCACATTTTACACAGTGACAGG + Intergenic
969103765 4:4789643-4789665 GGCATATCTTACCATGCGGCAGG - Intergenic
969996823 4:11321707-11321729 GGCACATCTTACATGGTGACAGG + Intergenic
971848003 4:31945506-31945528 GGCACATCTTACATGGTGACAGG - Intergenic
974253130 4:59414822-59414844 GGCACATCTTACGTGGTGACAGG - Intergenic
976727157 4:88225861-88225883 GGCACATCTTACATGGTGACAGG + Intronic
979829807 4:125285347-125285369 GGCACATCTTACATGGTGACAGG - Intergenic
981931618 4:150195910-150195932 GACGCATATTACTATGTGACAGG - Intronic
982572378 4:157066459-157066481 TGCACATGGTACAAGGTGACTGG + Intergenic
983487585 4:168350415-168350437 GGCACATCTTACATTGTGGCAGG - Intergenic
983847445 4:172537454-172537476 GGCACATGTTACCTGGTGGCAGG - Intronic
984654282 4:182300457-182300479 GGTACATGTTACCAGGTCACAGG + Intronic
987422577 5:17737797-17737819 GGCACATTTTACATGGTGACAGG - Intergenic
988229673 5:28459150-28459172 GGCACATGTTACAATGACATAGG + Intergenic
992601731 5:78408216-78408238 GGCACGTGTTACCTGGTGGCAGG + Intronic
993196774 5:84758482-84758504 GGCACATCTTACCTGGTGGCAGG - Intergenic
994864326 5:105246355-105246377 GGCACATCTTACCTGGTGGCAGG + Intergenic
998998155 5:147889451-147889473 GGCATATGTTACCATGTGAGAGG - Intronic
999371814 5:151060243-151060265 GTCACTTGCTACCATGTGAGAGG - Intronic
999446416 5:151643731-151643753 GACACATGCTACCATGTGGATGG - Intergenic
1004483791 6:16046476-16046498 GGCACATCTTACATGGTGACAGG - Intergenic
1006421989 6:33940441-33940463 GGCACATGGTCCCAGGTGACCGG - Intergenic
1006436036 6:34026646-34026668 GTCCCATGTTCCCAGGTGACTGG + Intronic
1010498093 6:76561011-76561033 AGCAGATGTTACCCTGTGTCAGG + Intergenic
1010846737 6:80718968-80718990 GGCACATGTTAGCATGTGCTAGG + Intergenic
1011345992 6:86370097-86370119 GGCACATCTTACATAGTGACAGG + Intergenic
1013578072 6:111505087-111505109 GTCACATGTAACCATTTGAAAGG + Intergenic
1014247606 6:119084055-119084077 GGCACATCTTACATTGTGGCAGG + Intronic
1015057841 6:128925349-128925371 GACACATGCTACCATATGAATGG + Intronic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1018239716 6:161761396-161761418 GCCACATGGTACAATGTAACAGG + Intronic
1024887695 7:54163205-54163227 GGCAAATGTTATCATGAGATAGG - Intergenic
1025861583 7:65335850-65335872 GGCACATCTTACATAGTGACAGG - Intergenic
1027938487 7:84639272-84639294 AGCACATATTATGATGTGACAGG - Intergenic
1027963330 7:84974707-84974729 GGCACATCTTACATGGTGACAGG + Intergenic
1030184218 7:106744882-106744904 GGCACAAGGTACCAGGTTACTGG + Intergenic
1031206649 7:118767473-118767495 GGCACATCTTACATGGTGACAGG + Intergenic
1031818910 7:126473879-126473901 GGCACATCTTACCTTGTGACAGG - Intronic
1034689139 7:153000011-153000033 GGCACATGTTACATGGTGGCAGG + Intergenic
1035859538 8:3012991-3013013 GGCACATCTTACATGGTGACAGG - Intronic
1036117593 8:5975121-5975143 GGCACATCTTACATGGTGACAGG + Intergenic
1037012355 8:13859292-13859314 GGCTCATGTTTTCATGTGAGAGG - Intergenic
1038167725 8:25101823-25101845 GTAACATGTTACCATGTAACAGG + Intergenic
1038625046 8:29184036-29184058 GTCACTTATTACCATGTAACTGG + Intronic
1039018564 8:33180553-33180575 GGCACATCTTACCTGGTGGCAGG - Intergenic
1039081850 8:33741357-33741379 GGCATATCTTACCATGTGGCAGG + Intergenic
1039150714 8:34502286-34502308 GGCACATGTTACATGGTGGCAGG + Intergenic
1039829068 8:41198502-41198524 GGCACATGAAACAATGTGATTGG + Intergenic
1040401324 8:47052474-47052496 GGCACATCTTACCTGGTGGCAGG - Intergenic
1043225561 8:77725009-77725031 GGCACATGTTTAAATGTGACAGG + Intergenic
1043307012 8:78806982-78807004 GCCACATATTTCCATTTGACTGG + Intergenic
1043858099 8:85285089-85285111 GGCACATCTTACCTGGTGGCAGG + Intergenic
1044315059 8:90740591-90740613 GGCACATCTTACATGGTGACAGG + Intronic
1044897204 8:96905138-96905160 GGCACATCTTACATGGTGACAGG + Intronic
1047893882 8:129343894-129343916 GTCACAGGTTCCCTTGTGACAGG - Intergenic
1049797400 8:144503031-144503053 GGCACAGGTTAACATGGGCCTGG - Intronic
1050803919 9:9650189-9650211 GGCACATCTTACATGGTGACAGG - Intronic
1056034076 9:82585150-82585172 GGCAGAGGGTACCATATGACTGG - Intergenic
1058645218 9:107125682-107125704 GACACGTGTGACCATGTAACTGG + Intergenic
1059907766 9:119007309-119007331 GGCACATCTTACCTGGTGGCAGG + Intergenic
1062347283 9:136120817-136120839 GGCACCTGTCATCTTGTGACAGG + Intergenic
1185646422 X:1618933-1618955 GGCACATGATACCATGTCATGGG + Intronic
1186066227 X:5768081-5768103 AGAACATGTCACCATGAGACAGG + Intergenic
1187431901 X:19232732-19232754 AGCACATTTTGCCATGTGACTGG + Intergenic
1191923093 X:66278429-66278451 GGCACATGTTACATGGTGGCAGG + Intergenic
1193467576 X:81867601-81867623 GGCACATCTTACATGGTGACAGG - Intergenic
1195578578 X:106476966-106476988 GACAGATATTACCATGTGAAAGG + Intergenic
1196718830 X:118834759-118834781 GGCCCATTTTATCATTTGACTGG + Intergenic
1199193436 X:144998264-144998286 GGCACATCTTACATGGTGACAGG - Intergenic
1200435676 Y:3146971-3146993 GGCACATCTTACCTGGTGGCAGG + Intergenic