ID: 927972906

View in Genome Browser
Species Human (GRCh38)
Location 2:27316847-27316869
Sequence CAGCGAGCAGATGCTGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927972902_927972906 2 Left 927972902 2:27316822-27316844 CCAATGACAGGCTGGGCGTGGAG 0: 1
1: 0
2: 4
3: 49
4: 360
Right 927972906 2:27316847-27316869 CAGCGAGCAGATGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 19
4: 187
927972901_927972906 3 Left 927972901 2:27316821-27316843 CCCAATGACAGGCTGGGCGTGGA 0: 1
1: 0
2: 0
3: 11
4: 170
Right 927972906 2:27316847-27316869 CAGCGAGCAGATGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 19
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927972906 Original CRISPR CAGCGAGCAGATGCTGGCGC AGG Intronic
900215334 1:1478673-1478695 GAGCGAGCAGATCCGGGCGCAGG + Exonic
900222595 1:1517340-1517362 GAGCGAGCAGATCCGGGCGCAGG + Exonic
900987048 1:6079132-6079154 CCGGGAGCTGATGCTGCCGCAGG + Intronic
903124519 1:21238546-21238568 CACGGAGCAGCTGCTGGCCCAGG + Intronic
906152293 1:43594572-43594594 CAGGGAAAAGATGGTGGCGCAGG + Intronic
906855327 1:49298240-49298262 CAAGGAACAGATGCTGGCCCAGG + Intronic
908580854 1:65515088-65515110 CAGCCAGCAGATGATGGTGGTGG + Intronic
909698246 1:78491320-78491342 CAGCCAGCAGAAGCTGTGGCTGG - Intronic
910259894 1:85284463-85284485 CAGAGAGGAGATCCTGGAGCAGG - Intergenic
910437164 1:87216978-87217000 CACCCAGCACATGCTGGAGCTGG + Intergenic
912219863 1:107661200-107661222 CAGCTAGCAGATCCTGGCATGGG - Intronic
913053193 1:115134699-115134721 CAGCACGCAGAGGCTGGCTCTGG - Intergenic
913961403 1:143340288-143340310 CAGAGAGCAGCTGCTGGAGAAGG + Intergenic
914055756 1:144165861-144165883 CAGAGAGCAGCTGCTGGAGAAGG + Intergenic
914123390 1:144800501-144800523 CAGAGAGCAGCTGCTGGAGAAGG - Intergenic
914914024 1:151807327-151807349 AAGTGAGCAGATGCTGCGGCTGG - Exonic
918257865 1:182766247-182766269 CAGAGAAAAGATGCTGGTGCTGG - Intergenic
920182135 1:204138494-204138516 CATGGAGCAGAGGCTGGCACTGG - Intronic
920218484 1:204378092-204378114 CGGAGAGCAGAAGCTGGAGCGGG + Intergenic
920298180 1:204972519-204972541 CAGAGAGCAGAGGCTGGAGAGGG - Intronic
920398470 1:205662798-205662820 CAGCCAGCAGAGGCTGGTGTGGG - Intronic
920915420 1:210254374-210254396 CAGGGAGCAGAAGGTGGGGCTGG - Intergenic
923457178 1:234174589-234174611 CAGCTAGCAGATGCTGAAACAGG + Intronic
923791979 1:237119465-237119487 AAGCATTCAGATGCTGGCGCAGG - Intronic
923862563 1:237906007-237906029 CAGTGAGCAGATTCTAGCTCTGG + Intergenic
1062862878 10:823763-823785 CAGGGAGCAGTTGCTAGCCCTGG - Intronic
1063771960 10:9214013-9214035 GAGCGAGCACAGGCTGGCCCAGG + Intergenic
1063968249 10:11363394-11363416 GAGAGCGCGGATGCTGGCGCAGG + Intergenic
1064577227 10:16758521-16758543 CAGCTAGCAAGTGCTGGAGCCGG - Intronic
1067015726 10:42755278-42755300 CAGTGGGGAGATGCTCGCGCTGG - Intergenic
1067164932 10:43857781-43857803 AAGCGCACAGATGCAGGCGCCGG + Intergenic
1072475504 10:95756177-95756199 CAGCAAGCAGAGGCTGGGGGGGG + Intronic
1072691114 10:97572839-97572861 CATCGAGCAGCGGCTGGCACAGG + Exonic
1076073711 10:127514684-127514706 CAGCTAGCAGAGGATGGCGATGG - Intergenic
1076732890 10:132447114-132447136 CCGGGAGCAGCTGCTGGGGCGGG + Intronic
1077975001 11:7238858-7238880 CAGAGAACAAATGCTGGCGAAGG + Intronic
1078631933 11:13010716-13010738 CGGCGAGCTGCTGCTGGAGCAGG + Intergenic
1080448234 11:32356945-32356967 AATGGAGCAGAAGCTGGCGCAGG - Intergenic
1080927675 11:36774998-36775020 CAGTGAGAGGATGCTGGCTCTGG + Intergenic
1084215967 11:67647032-67647054 CAGTGAGCACATGCTGGTGTGGG + Exonic
1084680175 11:70662383-70662405 CAGCCTGCGGATGCTCGCGCGGG - Intronic
1085643132 11:78205868-78205890 CATCAAGCAGCTGCTGGGGCAGG + Exonic
1087034698 11:93743560-93743582 GGGTGAGCAGATGCTGGAGCCGG + Intronic
1090955901 11:131512698-131512720 CAGCCAGCACATGCTGGGGCTGG - Intronic
1091054871 11:132408475-132408497 CAGGGAGCAGAGGCTGGTGAGGG - Intergenic
1091340283 11:134806667-134806689 CAGCGAGGAGATGCTGTTGATGG + Intergenic
1091681989 12:2533754-2533776 CAGGGAGCAGAGGCTGGAGAAGG + Intronic
1094088680 12:26623300-26623322 CAGCGTGGAGATGCTGGCAAAGG - Intronic
1094510369 12:31092756-31092778 CACCTAGAAGATGCTGGCCCTGG - Intronic
1104632428 12:130414567-130414589 CAGAGAGCACAGGCTGGGGCAGG + Intronic
1105517055 13:21100296-21100318 CAGCGAGGAGAGGCTTGCTCTGG - Intergenic
1105972934 13:25447502-25447524 CAGGGAGCAGGTGCAGGAGCTGG + Intronic
1106237501 13:27876240-27876262 CAGGGAGCAGAAGCTGCAGCTGG + Intergenic
1108322979 13:49304740-49304762 CAGTGAGCAGATGGTGGTGCAGG - Intergenic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1118775700 14:68972746-68972768 CAGCCAGCAAATGGTGGAGCTGG - Intronic
1119896262 14:78222270-78222292 CAGAGAGCAGCTGCTGGAGCAGG + Intergenic
1120683250 14:87506708-87506730 GAGGGAGCAGTTGCTGGAGCAGG - Intergenic
1122436846 14:101706412-101706434 GAGTGAGAAGCTGCTGGCGCCGG + Intergenic
1122627952 14:103093871-103093893 CAGCCAGAGGATGCTGGTGCAGG + Intergenic
1123041539 14:105492249-105492271 GCCCGAGCAGATGCTGGCCCAGG + Exonic
1125608484 15:40955747-40955769 CACCGAGCAGGCTCTGGCGCTGG + Exonic
1129810738 15:78507799-78507821 CAGCGAGCTGAGGATAGCGCGGG - Intronic
1131799346 15:96053384-96053406 CAGCGGGGAGCCGCTGGCGCTGG + Intergenic
1132743120 16:1425852-1425874 AGGCGAGCAGATTCTGGCTCAGG - Intergenic
1132853738 16:2035777-2035799 CAGCAAGCAGGGGCTGGGGCAGG - Intronic
1134046454 16:11104503-11104525 CAGAGAGCAGATCCTGGCCCAGG - Intronic
1134102480 16:11461810-11461832 GAGTGAGCAGGTGCTGGCCCTGG - Intronic
1135142726 16:19935561-19935583 CAGCTAGCAGGTGATGGAGCTGG + Intergenic
1135941815 16:26828396-26828418 CAGAGAGAAAATGCTGGAGCAGG - Intergenic
1141423319 16:83930958-83930980 ACGCAAGCAGGTGCTGGCGCAGG - Intronic
1141576089 16:84964282-84964304 CAGCAAGCACGTGCTGGCACAGG - Intergenic
1141630267 16:85283852-85283874 CAGCTAGGAAATGCTGGAGCTGG + Intergenic
1142145814 16:88492558-88492580 CAGCCAGCAGATGAGGGCCCTGG - Intronic
1142214045 16:88822191-88822213 CAGAGAGCAGAGGGTGGAGCTGG + Intronic
1142479193 17:207705-207727 AATCGGGCAGATGCTGGTGCAGG - Intergenic
1142485413 17:244554-244576 CAGGAAGAAGATGCTGGCCCCGG + Intronic
1142504313 17:353107-353129 AAGCGATGAGATGCTGACGCAGG - Intronic
1143325468 17:6095531-6095553 AAGCCAGAAGATGCTGGCTCGGG + Intronic
1143830419 17:9646061-9646083 CACCGAGCAGCTGGCGGCGCTGG + Exonic
1144439224 17:15266360-15266382 CTGTGAGCAGATGCTGGCTGTGG - Intergenic
1144735147 17:17551447-17551469 CAGGGTGGAGAAGCTGGCGCGGG + Intronic
1144838009 17:18167643-18167665 CAGCGAGCAGCTGCTGCAGCAGG + Exonic
1146185105 17:30719631-30719653 CAGCCAGGAGATGATGGGGCTGG + Intergenic
1146458001 17:33022040-33022062 CACTGAGCAGAAGCTGGCCCAGG + Intronic
1147015762 17:37490098-37490120 CAGGGAGCAGGTGGGGGCGCCGG - Intronic
1152844855 17:82593483-82593505 CAGCCAGCTGATCCTGGCACAGG - Intronic
1160387131 18:78503519-78503541 CAGCGAACACAGGCTGGCTCAGG + Intergenic
1160932426 19:1577042-1577064 CAGCGACCAGATCCTGGCTGGGG + Exonic
1162315537 19:9936272-9936294 CGGCGGGCAGGTGCGGGCGCGGG - Intronic
1162345404 19:10115443-10115465 CAGGGAGCAGGGGCTGGGGCAGG + Intronic
1162973674 19:14196058-14196080 CAGCCAGGAGATGATGGGGCTGG - Intronic
1163444347 19:17338049-17338071 TAGCGCGAAGATGGTGGCGCCGG - Exonic
1163587720 19:18173155-18173177 CGGAAAGCAGAAGCTGGCGCAGG - Intronic
1166222411 19:41374186-41374208 AAGAGTCCAGATGCTGGCGCTGG - Intronic
1166368287 19:42288054-42288076 CAGAGAGGAGCTGCTGGGGCAGG - Intronic
1167528759 19:50001778-50001800 CAGAGAGCAGATGGAGGAGCTGG - Intronic
1168585595 19:57588949-57588971 CAGCTAGCAGATGGGGGTGCAGG - Intronic
1202695239 1_KI270712v1_random:118538-118560 CAGAGAGCAGCTGCTGGAGAAGG + Intergenic
925280608 2:2682047-2682069 CAGGGTGCAGAGGCTGGCGGGGG + Intergenic
925298487 2:2793493-2793515 GAGGGAGGAGATGCTGGAGCTGG - Intergenic
926190007 2:10721489-10721511 CGGGGAGCAGGTGCAGGCGCCGG - Intergenic
927972906 2:27316847-27316869 CAGCGAGCAGATGCTGGCGCAGG + Intronic
932120053 2:69090432-69090454 CATGGAGGAGATGCTGGGGCAGG - Intronic
932463220 2:71896765-71896787 CAGTGAGCAGGTGGTGGAGCAGG - Intergenic
934276407 2:91575587-91575609 CAGAGAGCAGCTGCTGGAGAAGG + Intergenic
934924839 2:98375009-98375031 CAGCCTGCAGGTGCTGGAGCAGG + Intronic
934975081 2:98796419-98796441 GAGTGGTCAGATGCTGGCGCTGG + Intronic
940192785 2:151060297-151060319 CAGAGAACAGATGCTGTGGCAGG - Intergenic
941580723 2:167293207-167293229 CAGAGAAGTGATGCTGGCGCCGG + Intergenic
942278066 2:174336835-174336857 CAGCCAGCACCTGCTGGCCCAGG + Exonic
942460506 2:176165013-176165035 CTGCTAGCAGAAGCAGGCGCCGG + Intronic
942738511 2:179145323-179145345 CAGCTAGTAAATGCTGGAGCTGG - Intronic
948713020 2:239836906-239836928 CAGAGAGGAGATGCTGGGGTGGG - Intergenic
1168841332 20:911940-911962 CAGCCAGCAGCTGCTGGCCTGGG - Intronic
1170893058 20:20392055-20392077 CAGCGAAGAGCTGCTGGCGCAGG - Intronic
1171261180 20:23735947-23735969 CAGGTAGCAGCTGCTGGCTCAGG - Intergenic
1171270310 20:23811838-23811860 CAGGTAGCAGCTGCTGGCTCAGG - Intergenic
1172198556 20:33109051-33109073 CAGGGGTCAGATGCTGGCTCTGG + Intronic
1175176724 20:57117005-57117027 CAGAGAGCAGATGCACGCGGAGG - Intergenic
1175552384 20:59825966-59825988 CAGTGAGAAGATGCTGTCTCTGG + Intronic
1179783991 21:43719481-43719503 CTGCGGGCAGAGCCTGGCGCGGG + Intronic
1179901759 21:44397827-44397849 CTCGGAGGAGATGCTGGCGCTGG + Exonic
1180009134 21:45038306-45038328 CAGCATGCAGATGCTGGCGGCGG + Intergenic
1180177516 21:46097885-46097907 CAGCGGGCAGGGGCTGGCGGGGG + Intergenic
1180813899 22:18777970-18777992 CAGCGAGTAGATGAAGGAGCTGG + Intergenic
1181465298 22:23107599-23107621 TAGGGAGCAGAAGCTGGGGCGGG + Intronic
1181701651 22:24624654-24624676 CAGCGAGTAGATGAAGGAGCTGG - Intronic
1182321112 22:29479193-29479215 CAGTGTGCAGAAGCTGGCTCGGG + Intergenic
1182527801 22:30932496-30932518 CAGAGAGCTGCTGCTGGCCCTGG + Intronic
1183306122 22:37084153-37084175 GAGCGAGCAGAGGCTGGGGCTGG - Intronic
1203226752 22_KI270731v1_random:82619-82641 CAGCGAGTAGATGAAGGAGCTGG - Intergenic
1203263998 22_KI270734v1_random:3657-3679 CAGCGAGTAGATGAAGGAGCTGG + Intergenic
951906713 3:27714123-27714145 CAGGGAGGAGATACTGGCTCGGG - Intergenic
952816593 3:37452413-37452435 CCGCGCGCTGCTGCTGGCGCTGG + Exonic
953748858 3:45594750-45594772 CAGCGGGGAGATGCTGGCGAAGG - Intronic
953802086 3:46031930-46031952 CAGAGAGGAGATGCTGGAGTGGG - Intergenic
957919683 3:86731743-86731765 CACCGAGCCCATGCTCGCGCTGG + Intergenic
961348263 3:126278826-126278848 CAGCGAGTAGGTGGTGACGCTGG - Intergenic
961387203 3:126529443-126529465 AAGGGTGCAGATGCTGGCACCGG + Intronic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
966233603 3:177675364-177675386 AAGCAAGCAGATGCTGGGCCAGG - Intergenic
967214658 3:187199887-187199909 CAGCGAGAAGCTGCTGGAGGAGG + Exonic
967266797 3:187698653-187698675 CAGCGAGAAGCTGCTGGAGGAGG - Exonic
967805759 3:193713418-193713440 CAGGGACCATATGCTGGCCCTGG - Intergenic
968490026 4:885056-885078 CACCGAGCAGGTGCTGACTCAGG + Intronic
968490035 4:885125-885147 CACCGAGCAGGTGCTGACACAGG + Intronic
968577968 4:1376749-1376771 CAGCGAGCTGTGGCAGGCGCTGG - Intronic
969114518 4:4862771-4862793 CACCGCGCAGCTGCTGGCGCTGG + Exonic
969131665 4:4994961-4994983 CAGCGAGCAGGCGCTGGATCTGG + Intergenic
969209335 4:5674594-5674616 CAGCGTGCAGATGCTGGTCAGGG + Intronic
969261257 4:6035622-6035644 CAGCGTGCAGATGCTGGAGAAGG + Intronic
970565129 4:17324487-17324509 CAGCGAACAGATTCTGGGGGTGG - Intergenic
981755040 4:148133683-148133705 CAGTAACCAGAAGCTGGCGCAGG + Intronic
984745157 4:183208071-183208093 GAAGGAGCAGAGGCTGGCGCTGG + Exonic
985790988 5:1926660-1926682 CAGCGGGCAGGTGCTGGGGCCGG - Intergenic
986687097 5:10284168-10284190 CAGCGGCCAGAAGGTGGCGCCGG + Intronic
997660396 5:135585023-135585045 CACTGAGCAGACGCTGGCGATGG + Intergenic
998011581 5:138699644-138699666 CAGAGAGCAAAGGCTGGCGTGGG + Intronic
999318370 5:150598779-150598801 CAGCAAGCTGATGGTGGCGGTGG + Intergenic
999459203 5:151743110-151743132 CAGGGTGCAGATGCAGGAGCAGG + Intronic
999887132 5:155936415-155936437 CAGAGAGCAGACGCTGGGGTGGG + Intronic
1002052530 5:176579402-176579424 CAGCCAGTAAATGATGGCGCTGG + Intronic
1002297567 5:178240023-178240045 CAGCCAGCACAGGCTGGAGCAGG - Intronic
1003459942 6:6320263-6320285 CAGGGAGCAGATTATGGAGCTGG - Intronic
1004393426 6:15227982-15228004 CAGAGATCAGATGCAGGGGCTGG + Intergenic
1004475300 6:15966046-15966068 CAGCAAGGAGAGGCTGGCCCTGG + Intergenic
1006181312 6:32154882-32154904 CAGGGAGCTGGTGCTGGCGTGGG + Intronic
1006183497 6:32167616-32167638 CAGCGACCAGGTGCTGCTGCTGG + Exonic
1006364974 6:33610003-33610025 CAGGCAGCAGGTGCTGGGGCTGG - Intergenic
1007514161 6:42398133-42398155 CAGCTAGCAAGTGCTGGAGCTGG - Intronic
1009870747 6:69450105-69450127 CAGCAGGCAGATCCAGGCGCCGG + Intergenic
1014778999 6:125541862-125541884 CCTGGAGCAGATGCTGGCTCAGG + Intergenic
1017681581 6:156869992-156870014 CAGGGAGCAGTGGCTGGGGCAGG + Intronic
1017824371 6:158070686-158070708 CAGCGAGCAGATGCACCAGCAGG + Intronic
1018199042 6:161378579-161378601 CAGCCTGCAGATGCTAGTGCTGG - Intronic
1019387763 7:768019-768041 CAGCGAGCAGGAGCTGGCGCTGG + Intronic
1019387775 7:768078-768100 CAGCGAGCGGGAGCTCGCGCTGG + Intronic
1019387846 7:768487-768509 CAGCGAGCAGGAGCTCGCGCTGG + Intronic
1020016485 7:4834801-4834823 CCAGGAGCAGCTGCTGGCGCCGG + Exonic
1022559745 7:31336243-31336265 TGCCGAGCAGCTGCTGGCGCGGG - Intergenic
1023871993 7:44268352-44268374 CAGCCTGCAGATGCTGGCTGTGG + Intronic
1029319088 7:99741566-99741588 CAGCAAGCAAATGCTGGAGAGGG + Intergenic
1035168784 7:157006562-157006584 CAGCCAGCAGCTGCTGGAGCTGG - Exonic
1036910724 8:12755240-12755262 CCGCGGGGAGCTGCTGGCGCTGG - Exonic
1041244795 8:55879954-55879976 CGGCGAGGGGCTGCTGGCGCGGG - Exonic
1046640807 8:116728763-116728785 CAGCTAGTAAATGCTGGAGCTGG - Intronic
1049210423 8:141384008-141384030 CAGCAAGGAAATGCAGGCGCGGG - Intergenic
1049223673 8:141439633-141439655 CAGCTAGAAGGTGCTGGAGCGGG + Intergenic
1049290049 8:141797097-141797119 CAGCGTGGAGATGCTAGAGCTGG + Intergenic
1049621236 8:143599219-143599241 CAGCGGGGAGCCGCTGGCGCAGG - Exonic
1049688768 8:143949796-143949818 GTGCGAGGAGGTGCTGGCGCCGG - Intronic
1049749180 8:144275447-144275469 CAGCGTGGAGAGGCTGGCACCGG - Intronic
1049749190 8:144275482-144275504 CAGCGTGGAGAGGCTGGCACCGG - Intronic
1049749200 8:144275517-144275539 CAGCGTGGAGAGGCTGGCACCGG - Intronic
1053022197 9:34702366-34702388 CTCCGAGCAGAAGCTGGCGCTGG + Intergenic
1056595860 9:88007156-88007178 CAGCGTTCAGATGCTCGTGCGGG - Intergenic
1057509187 9:95663563-95663585 CACCGGGCAGAAGCTGGCCCAGG + Intergenic
1057748253 9:97769795-97769817 GAGCGAGCAGATGCTGGAAGTGG - Intergenic
1058527343 9:105873177-105873199 CAGCAAGTAGGTGCTGGAGCTGG - Intergenic
1059739477 9:117135745-117135767 CACAGAGCAGATGCTGAGGCTGG + Intronic
1059749872 9:117237879-117237901 CAGAGAGGAGATGCTGGTGCTGG + Intronic
1060147609 9:121266314-121266336 CTGAGAGCAGTTGCTGGGGCTGG + Intronic
1062151536 9:135021689-135021711 CATGGAGCAGCTGCTGGTGCTGG + Intergenic
1062340294 9:136091061-136091083 CAGGGAGGAGAGGCTGGCTCCGG - Intronic
1185709696 X:2293629-2293651 GAGCGAGCAGAGGCTGGTTCTGG + Intronic
1192240486 X:69324132-69324154 CAGCCTCCAGATGCTGGCGCTGG - Intergenic
1195881732 X:109600244-109600266 CAGCGCGGAGAGGCAGGCGCGGG + Intergenic