ID: 927973664

View in Genome Browser
Species Human (GRCh38)
Location 2:27322091-27322113
Sequence ATGGCATAGGGCCCCCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927973664_927973669 27 Left 927973664 2:27322091-27322113 CCTTTGTGGGGGCCCTATGCCAT 0: 1
1: 0
2: 1
3: 5
4: 73
Right 927973669 2:27322141-27322163 GTAAAATGTTTTCCAAGTTGAGG 0: 1
1: 0
2: 1
3: 28
4: 282
927973664_927973668 5 Left 927973664 2:27322091-27322113 CCTTTGTGGGGGCCCTATGCCAT 0: 1
1: 0
2: 1
3: 5
4: 73
Right 927973668 2:27322119-27322141 ATATGAAAGTGCTTTGCATACGG 0: 1
1: 0
2: 3
3: 36
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927973664 Original CRISPR ATGGCATAGGGCCCCCACAA AGG (reversed) Intronic