ID: 927973664

View in Genome Browser
Species Human (GRCh38)
Location 2:27322091-27322113
Sequence ATGGCATAGGGCCCCCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927973664_927973668 5 Left 927973664 2:27322091-27322113 CCTTTGTGGGGGCCCTATGCCAT 0: 1
1: 0
2: 1
3: 5
4: 73
Right 927973668 2:27322119-27322141 ATATGAAAGTGCTTTGCATACGG 0: 1
1: 0
2: 3
3: 36
4: 296
927973664_927973669 27 Left 927973664 2:27322091-27322113 CCTTTGTGGGGGCCCTATGCCAT 0: 1
1: 0
2: 1
3: 5
4: 73
Right 927973669 2:27322141-27322163 GTAAAATGTTTTCCAAGTTGAGG 0: 1
1: 0
2: 1
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927973664 Original CRISPR ATGGCATAGGGCCCCCACAA AGG (reversed) Intronic
901029485 1:6298752-6298774 ATGGCAAGGGGCCTCCATAAAGG + Intronic
904095433 1:27973200-27973222 ATGGCTTAGGGCTTCCACAAAGG + Exonic
910159116 1:84254664-84254686 TTAGCACAGGGCCCTCACAATGG - Intergenic
915245138 1:154551246-154551268 AGGGCCTAGGGTGCCCACAATGG - Intronic
918521504 1:185420117-185420139 ATGGAAGAGGTCCTCCACAATGG - Intergenic
919984205 1:202661541-202661563 GTGGCATAGGGCAACCACGAGGG - Intronic
1073773697 10:106763054-106763076 ATGACATAGGCACACCACAATGG - Intronic
1085760463 11:79236963-79236985 ATGGCATAGGGCTCCTTTAACGG - Intronic
1092074609 12:5662837-5662859 ATGGGATAGGACCCCAAAAAAGG + Intronic
1094838362 12:34332743-34332765 ATGGCAGAGGTCCCCCACCATGG + Intergenic
1094844372 12:34354985-34355007 ATGGCAGAGGTCCCTCCCAATGG - Intergenic
1094850169 12:34378789-34378811 ATGGCAGAGGTCCCCCCCATGGG - Intergenic
1094850865 12:34381780-34381802 GTGGCAGAGGTCCCCCCCAAGGG - Intergenic
1094852697 12:34389361-34389383 ATGGCAGAGGTCCCCCCCAACGG + Intergenic
1094856442 12:34404992-34405014 GTGGCAGAGGTCCCCCACTATGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107965005 13:45589933-45589955 AGGGCACAGGGCTCCCACATGGG - Intronic
1114162356 14:20182631-20182653 CTGGCTTATGGGCCCCACAAGGG - Intergenic
1119560990 14:75589625-75589647 ACTGCAGAGAGCCCCCACAAGGG - Intronic
1120342896 14:83244922-83244944 ATGGCAGGGGGCTGCCACAAAGG - Intergenic
1122989170 14:105228780-105228802 ATGGCATGGGGACCACACAGAGG - Intronic
1125007716 15:34836961-34836983 ATGTCTTAGTGACCCCACAATGG + Intergenic
1125534833 15:40436880-40436902 AAGGCATAGGGCCCCAAAGAGGG + Intergenic
1128126412 15:65196550-65196572 TTGGCACGTGGCCCCCACAATGG - Exonic
1130846044 15:87747091-87747113 ATGGTACAGGGGACCCACAAGGG - Intergenic
1134191079 16:12121657-12121679 AAGGCAGAGGGCCACCAAAAAGG - Intronic
1135498013 16:22969539-22969561 ATTGAATAGGGCCCCTGCAAGGG - Intergenic
1136386462 16:29929457-29929479 CTGGAATAAGGCCCCCACACTGG + Intergenic
1152348309 17:79768464-79768486 TTGGGTTAGGGCCACCACAATGG - Intergenic
1161293811 19:3509350-3509372 ATGACACACCGCCCCCACAACGG + Intronic
1166533247 19:43554880-43554902 AGGGCACAGGGCCCACACAGGGG + Intronic
927933071 2:27058192-27058214 ATGGAAGAGGGCCCCCAAATTGG + Intronic
927973664 2:27322091-27322113 ATGGCATAGGGCCCCCACAAAGG - Intronic
931008602 2:57881424-57881446 ATGTAATAGGGCCCCAACAGTGG + Intergenic
941411553 2:165162797-165162819 CTGGATCAGGGCCCCCACAATGG + Exonic
941423269 2:165310332-165310354 CTGGATCAGGGCCCCCACAATGG - Exonic
946152314 2:217785025-217785047 ATGACCAAGGGCCCCCACACAGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1175699293 20:61125450-61125472 ATGGCAAATGGGCCCCACCAGGG + Intergenic
1181005739 22:20012642-20012664 ATGCCATGGGACCCCCACACTGG + Intronic
1181374474 22:22445479-22445501 ATGCCATAAGACCTCCACAATGG - Intergenic
1183299804 22:37053258-37053280 ATGGCTTGGGGCCTCCACAGAGG - Intronic
1184188343 22:42878989-42879011 ATTGCCCAGGGCCCCCACCATGG + Intronic
953815722 3:46154618-46154640 ATGACAGATGGCCACCACAAAGG + Intergenic
961442497 3:126961276-126961298 ATGGCATGGGGACTCCCCAAGGG - Intergenic
968254207 3:197251005-197251027 ATTGAATAGGACCCCCAAAATGG + Intronic
968592553 4:1466210-1466232 ACGGCATAGAGCCCACACCAAGG - Intergenic
968620548 4:1601756-1601778 ATAGCTTAGGGCCCCCAGGAGGG - Intergenic
968816322 4:2823625-2823647 ATGGCCTGGGGCCCACACAAAGG + Intronic
969675316 4:8611289-8611311 ACGGCCCAGAGCCCCCACAAAGG + Intronic
976460200 4:85302380-85302402 ATGGTATCAGGCCCCCACCAGGG - Intergenic
977478684 4:97545498-97545520 ATGGCTTAGGGCCATCACCAGGG - Intronic
984700177 4:182814044-182814066 ATGCCAAAGGGACCCCACAGGGG + Intergenic
988320326 5:29686439-29686461 ACTGCAGAGAGCCCCCACAAGGG - Intergenic
989742449 5:44789098-44789120 CTGGATTAGAGCCCCCACAATGG - Intergenic
992748055 5:79838147-79838169 GTGGCTTAGGGCCTCCAGAAAGG + Intergenic
996552110 5:124741930-124741952 TTGGCACAGGGGCCCCTCAAAGG - Intronic
1005478253 6:26230230-26230252 ATGGCATAGGTCTGACACAAAGG - Intergenic
1009395038 6:63189845-63189867 ATGTGAGAGGGCCCCCACGATGG - Intergenic
1021037118 7:15813416-15813438 ATTGCATTGGGGCACCACAAAGG + Intergenic
1030339617 7:108362286-108362308 ATGACACAGGGCCCTCACGATGG - Intronic
1030713452 7:112781529-112781551 ATGGCATAGTGCTAGCACAATGG + Intronic
1034244567 7:149634750-149634772 AGGGCAAAAGGCACCCACAATGG - Intergenic
1040285908 8:46100256-46100278 CTCGCAGAAGGCCCCCACAAAGG - Intergenic
1040290157 8:46120104-46120126 CTCGCAAAAGGCCCCCACAAGGG - Intergenic
1043076563 8:75708472-75708494 ATGGCATGGGGCCACCAGCAAGG + Intergenic
1045498642 8:102728757-102728779 ATGGCATAGAGCCCTCAGGAGGG - Intergenic
1048026996 8:130596264-130596286 ATGGCAGAGGGCCCCCGCAATGG - Intergenic
1050367317 9:4884518-4884540 ATGTGACAGGGCACCCACAAAGG + Intronic
1050557741 9:6804328-6804350 ATGGCATAGTACTCCCACCATGG - Intronic
1054871744 9:70053497-70053519 TTGGCCTAGGGCCGCCACCAAGG - Intronic
1058695233 9:107553513-107553535 ATAGTATAGGGCCCACACAGTGG + Intergenic
1059563841 9:115362929-115362951 ATAGCATAGGGACTCCCCAAGGG - Intronic
1062515662 9:136933961-136933983 ATGGCAGAGAGCCCACACTAGGG + Intronic
1188398342 X:29714139-29714161 ATGGCATAGGGACTCCATTAAGG + Intronic
1189234457 X:39476790-39476812 ACGGCATGGGCCCTCCACAAAGG - Intergenic
1192052149 X:67734066-67734088 ATGGCACAGGGTTCCCAAAATGG + Intergenic
1193883759 X:86960134-86960156 AAGGCTTGGGGCCCCCACACTGG + Intergenic
1196009328 X:110870344-110870366 ATGGCATAGGGCCCACAAGAAGG + Intergenic
1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG + Intergenic