ID: 927973668

View in Genome Browser
Species Human (GRCh38)
Location 2:27322119-27322141
Sequence ATATGAAAGTGCTTTGCATA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927973660_927973668 18 Left 927973660 2:27322078-27322100 CCTAGCTCACACACCTTTGTGGG 0: 1
1: 0
2: 0
3: 19
4: 221
Right 927973668 2:27322119-27322141 ATATGAAAGTGCTTTGCATACGG 0: 1
1: 0
2: 3
3: 36
4: 296
927973658_927973668 21 Left 927973658 2:27322075-27322097 CCTCCTAGCTCACACACCTTTGT 0: 1
1: 0
2: 0
3: 12
4: 164
Right 927973668 2:27322119-27322141 ATATGAAAGTGCTTTGCATACGG 0: 1
1: 0
2: 3
3: 36
4: 296
927973657_927973668 22 Left 927973657 2:27322074-27322096 CCCTCCTAGCTCACACACCTTTG 0: 1
1: 0
2: 1
3: 13
4: 198
Right 927973668 2:27322119-27322141 ATATGAAAGTGCTTTGCATACGG 0: 1
1: 0
2: 3
3: 36
4: 296
927973664_927973668 5 Left 927973664 2:27322091-27322113 CCTTTGTGGGGGCCCTATGCCAT 0: 1
1: 0
2: 1
3: 5
4: 73
Right 927973668 2:27322119-27322141 ATATGAAAGTGCTTTGCATACGG 0: 1
1: 0
2: 3
3: 36
4: 296
927973665_927973668 -7 Left 927973665 2:27322103-27322125 CCCTATGCCATAACGTATATGAA 0: 1
1: 0
2: 1
3: 9
4: 135
Right 927973668 2:27322119-27322141 ATATGAAAGTGCTTTGCATACGG 0: 1
1: 0
2: 3
3: 36
4: 296
927973666_927973668 -8 Left 927973666 2:27322104-27322126 CCTATGCCATAACGTATATGAAA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 927973668 2:27322119-27322141 ATATGAAAGTGCTTTGCATACGG 0: 1
1: 0
2: 3
3: 36
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927973668 Original CRISPR ATATGAAAGTGCTTTGCATA CGG Intronic