ID: 927973669

View in Genome Browser
Species Human (GRCh38)
Location 2:27322141-27322163
Sequence GTAAAATGTTTTCCAAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927973664_927973669 27 Left 927973664 2:27322091-27322113 CCTTTGTGGGGGCCCTATGCCAT 0: 1
1: 0
2: 1
3: 5
4: 73
Right 927973669 2:27322141-27322163 GTAAAATGTTTTCCAAGTTGAGG 0: 1
1: 0
2: 1
3: 28
4: 282
927973665_927973669 15 Left 927973665 2:27322103-27322125 CCCTATGCCATAACGTATATGAA 0: 1
1: 0
2: 1
3: 9
4: 135
Right 927973669 2:27322141-27322163 GTAAAATGTTTTCCAAGTTGAGG 0: 1
1: 0
2: 1
3: 28
4: 282
927973666_927973669 14 Left 927973666 2:27322104-27322126 CCTATGCCATAACGTATATGAAA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 927973669 2:27322141-27322163 GTAAAATGTTTTCCAAGTTGAGG 0: 1
1: 0
2: 1
3: 28
4: 282
927973667_927973669 8 Left 927973667 2:27322110-27322132 CCATAACGTATATGAAAGTGCTT 0: 1
1: 0
2: 2
3: 7
4: 101
Right 927973669 2:27322141-27322163 GTAAAATGTTTTCCAAGTTGAGG 0: 1
1: 0
2: 1
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927973669 Original CRISPR GTAAAATGTTTTCCAAGTTG AGG Intronic