ID: 927973674

View in Genome Browser
Species Human (GRCh38)
Location 2:27322164-27322186
Sequence GATAAAGGCATTGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927973674_927973680 7 Left 927973674 2:27322164-27322186 CCTCCTGGGGCAATGCCTTTATC 0: 1
1: 0
2: 0
3: 12
4: 260
Right 927973680 2:27322194-27322216 GCTGACTGTTCAGCTTTTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927973674 Original CRISPR GATAAAGGCATTGCCCCAGG AGG (reversed) Intronic
900143131 1:1146826-1146848 GCTAAAGGCACTGCCCCCGACGG - Intergenic
900471318 1:2856384-2856406 GACATAGGCTTGGCCCCAGGAGG - Intergenic
901440846 1:9277403-9277425 GATAATGGCATGAACCCAGGAGG - Intergenic
901532835 1:9864218-9864240 GACCAGGGCATGGCCCCAGGAGG + Intronic
902223929 1:14984583-14984605 GATACATGCATTGCTACAGGGGG - Intronic
902712791 1:18252138-18252160 GAGAATGGCATGGACCCAGGAGG - Intronic
902925124 1:19690956-19690978 GAGAATGGCATGACCCCAGGAGG - Intronic
903439264 1:23375154-23375176 GATAATGGCATGAACCCAGGAGG + Intergenic
908412128 1:63877525-63877547 GGTAAAGGGATTGGCCCTGGAGG + Intronic
912627129 1:111214709-111214731 GATAAAGGAATTTGCACAGGGGG - Intronic
915179055 1:154042514-154042536 GATAATGGCATGAACCCAGGAGG - Intronic
915328476 1:155093617-155093639 GATATGGGCATGGCCCCACGTGG - Intergenic
916825931 1:168441845-168441867 GATAACTGCAGTGCCCCAGGTGG + Intergenic
917861051 1:179144368-179144390 GAGAAAGGCATGAACCCAGGAGG + Intronic
917961444 1:180148835-180148857 GAGAATGGCATGGACCCAGGAGG - Intergenic
918587049 1:186200337-186200359 GAGAAAGGCATGAACCCAGGAGG + Intergenic
918907247 1:190513094-190513116 GATAATGGCATGGACCCATGAGG - Intergenic
919790976 1:201290727-201290749 GTTCAGGGCATTGCCCCAGCTGG - Intronic
920849786 1:209620987-209621009 GAGAGAGGCCTGGCCCCAGGGGG - Intronic
920851355 1:209630241-209630263 GAGACAGGCAGTGACCCAGGAGG - Intronic
922602293 1:226865778-226865800 CATAAAATCATTGACCCAGGAGG - Intergenic
923118883 1:230971254-230971276 GAGAATGGCATGGACCCAGGAGG + Intronic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1063426074 10:5951050-5951072 GAGAATGGCATGGACCCAGGAGG + Intronic
1064613115 10:17124516-17124538 GAGAATGGCATGGACCCAGGAGG - Intronic
1066189414 10:33042230-33042252 GATAATGGCTTTGCCCTTGGGGG - Intergenic
1068687008 10:59881015-59881037 GATAAAGGGAGTGCAGCAGGGGG - Intronic
1069586028 10:69602991-69603013 GATAACTGCAGTGCACCAGGTGG - Intergenic
1070538805 10:77401244-77401266 GATAATGGCACGGACCCAGGAGG - Intronic
1071333510 10:84583802-84583824 GATAAAGGCACTGCCCAGTGGGG + Intergenic
1072523810 10:96253929-96253951 GAGAATGGCATGGACCCAGGAGG + Intronic
1073251473 10:102122336-102122358 GATAAAGCTAGTGTCCCAGGTGG - Intergenic
1073282803 10:102367045-102367067 GAGAAGGGCATTGACACAGGCGG + Intronic
1073787157 10:106901952-106901974 GAGAATGGCATGACCCCAGGAGG + Intronic
1074173189 10:110965886-110965908 GATAAAGGTATTGCCTCTGTGGG + Intronic
1074337340 10:112591428-112591450 GAGAATGGCATTAACCCAGGAGG + Intronic
1075662785 10:124209737-124209759 AATGAAGGCATTGGGCCAGGAGG + Intergenic
1075903169 10:126059566-126059588 CATAAATGCACTGCCCCAAGTGG + Intronic
1078044458 11:7900423-7900445 GAGAATGGCATGGACCCAGGGGG + Intergenic
1079106918 11:17577726-17577748 GAGAAAGGCATAGGCACAGGAGG - Intronic
1080062981 11:27977172-27977194 GAGAAAGGCATTTGCCTAGGTGG - Intergenic
1080779799 11:35419565-35419587 GTTAAAGGAGTTGCCCGAGGCGG - Intronic
1081673247 11:44953507-44953529 GAGAATGGCATGGACCCAGGAGG - Intergenic
1086738151 11:90332938-90332960 GATAATGGCATAAACCCAGGAGG - Intergenic
1087467700 11:98530314-98530336 GAGAATGGCATGACCCCAGGAGG - Intergenic
1089829067 11:121309212-121309234 GAGAAAGGCAGAGCCCCAAGAGG - Intergenic
1095043149 12:37466663-37466685 GAGAATGGCATTAACCCAGGAGG + Intergenic
1095188529 12:39229504-39229526 GAGAATGGCATGGACCCAGGAGG + Intergenic
1096170752 12:49467791-49467813 GAGAATGGCATAGACCCAGGAGG - Intronic
1097219259 12:57437579-57437601 GAGAATGGCATGGACCCAGGAGG + Intronic
1097269861 12:57767284-57767306 GACAAAGGCACTCTCCCAGGAGG - Intronic
1097280067 12:57839626-57839648 GAGAATGGCATAGACCCAGGAGG + Intronic
1098098908 12:66991407-66991429 GAATAAGGCATTGCCACAGCAGG + Intergenic
1098966419 12:76793973-76793995 GAGAAAGGCATGAACCCAGGAGG - Intronic
1101857774 12:108458175-108458197 AATAAAGGCATGACTCCAGGGGG - Intergenic
1101915417 12:108892250-108892272 GAGAAAGGCATGAACCCAGGAGG - Intronic
1104508809 12:129357155-129357177 GAGAATGGCATGGACCCAGGAGG + Intronic
1106219688 13:27735240-27735262 GAGAATGGCATGGACCCAGGAGG + Intergenic
1106873624 13:34048353-34048375 GAGAATGGCATTAACCCAGGAGG + Intergenic
1107314886 13:39120197-39120219 GAAAAATGTAGTGCCCCAGGTGG + Intergenic
1107796275 13:44055357-44055379 TATAAAGGTATTGCCACAAGTGG - Intergenic
1110114785 13:71799527-71799549 AATAATGTCATTGCCCCATGTGG - Intronic
1111758608 13:92432439-92432461 GAGAAAGGCATGAACCCAGGAGG - Intronic
1113545769 13:111148272-111148294 GACAAAGGCATAGACCCAAGGGG + Intronic
1114132705 14:19811334-19811356 GAGAATGGCATTAACCCAGGAGG - Intronic
1114919748 14:27311802-27311824 GAGAAATGCAGTGCACCAGGGGG - Intergenic
1115481375 14:33864540-33864562 GAGAATGGCATTAACCCAGGGGG + Intergenic
1115882726 14:37938141-37938163 GAGAAAGGCATGAACCCAGGAGG - Intronic
1118048793 14:62003920-62003942 GAGAAAGGCATTCCACCTGGAGG + Intronic
1118690095 14:68329890-68329912 GAGAAAGGCATGAACCCAGGAGG + Intronic
1120006760 14:79367071-79367093 GAGAAAGGCATGAACCCAGGAGG - Intronic
1120366715 14:83580569-83580591 GAGAATGGCATGGACCCAGGAGG + Intergenic
1121047675 14:90799917-90799939 GAGAATGGCATGACCCCAGGAGG - Intronic
1121064696 14:90951770-90951792 GATAAGGGCATTACCCCCAGAGG + Intronic
1202882323 14_KI270722v1_random:72284-72306 GATAATGGCCTTAACCCAGGAGG + Intergenic
1125366831 15:38926603-38926625 GAGAAAGGCATGAACCCAGGAGG - Intergenic
1127726854 15:61758859-61758881 GATAAAGTAATTGACCCACGTGG + Intergenic
1128646459 15:69382160-69382182 AATAGAAGCAATGCCCCAGGTGG - Intronic
1130037492 15:80375032-80375054 GAGAAAGGCATGAACCCAGGAGG - Exonic
1131518678 15:93097259-93097281 GAGAATGGCATTTACCCAGGAGG - Intergenic
1133308603 16:4827808-4827830 GAGAATGGCATTAACCCAGGAGG + Intronic
1133379918 16:5321407-5321429 GATAATGGCATGAACCCAGGAGG - Intergenic
1135708627 16:24696256-24696278 GAGAATGGCATGGACCCAGGAGG + Intergenic
1136457651 16:30390708-30390730 GATAATGGCATGAACCCAGGAGG - Intronic
1138617107 16:58177480-58177502 CACAAAGGCATGGCCACAGGTGG + Intronic
1139408085 16:66735594-66735616 GAGAATGGCATTAACCCAGGAGG - Intronic
1141773436 16:86105718-86105740 GAGAATGGCATTAACCCAGGAGG - Intergenic
1143877890 17:10006417-10006439 GAGAATGGCATGGACCCAGGAGG - Intronic
1144143354 17:12371648-12371670 GAGGAAGGCATTCCCCAAGGAGG - Intergenic
1145412372 17:22680180-22680202 GAGAATGGCATGGACCCAGGAGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147170557 17:38616455-38616477 GATGAAGGCCTGGCACCAGGGGG + Intergenic
1149825078 17:59821058-59821080 GAGAATGGCATGGACCCAGGAGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151420616 17:73994672-73994694 GAGAATGGCATGACCCCAGGAGG + Intergenic
1151513815 17:74579479-74579501 GAGAAGGGAATAGCCCCAGGTGG + Exonic
1152293357 17:79453284-79453306 GATGAAGCCACTGCCCCAGAGGG - Intronic
1154469134 18:14681399-14681421 GAGAATGGCATGACCCCAGGAGG - Intergenic
1154975137 18:21450150-21450172 GATAAAGCCAGTGCCACAGGTGG + Intronic
1155994960 18:32321436-32321458 GATAGAGGAGTTCCCCCAGGAGG - Intronic
1156133088 18:34002354-34002376 GCTAAAGGTCTAGCCCCAGGTGG - Intronic
1157548611 18:48565224-48565246 GATGAAGGCAGTGCCACAGCAGG - Intronic
1161413903 19:4133659-4133681 GAGAATGGCATGACCCCAGGAGG + Intergenic
1162164201 19:8741118-8741140 GAGAATGGCATGACCCCAGGAGG - Intergenic
1162165273 19:8748587-8748609 GAGAATGGCATGACCCCAGGAGG - Intergenic
1162166338 19:8756041-8756063 GAGAATGGCATGACCCCAGGAGG - Intergenic
1162167404 19:8763497-8763519 GAGAATGGCATGACCCCAGGAGG - Intergenic
1162169411 19:8777250-8777272 GAGAATGGCATGACCCCAGGAGG - Intergenic
1162170092 19:8782562-8782584 GAGAATGGCATGACCCCAGGAGG - Intergenic
1162328804 19:10014253-10014275 GGTGAGGGCATTGCCCCAGTTGG + Intronic
1162658547 19:12151468-12151490 GAGAAAGGCGTTAACCCAGGAGG - Intronic
1163802399 19:19374361-19374383 GAGAAAGGCATGAACCCAGGAGG - Intergenic
1164221804 19:23201745-23201767 GAGAAAGGCATGAACCCAGGAGG - Intergenic
1164330282 19:24247837-24247859 GATAAAGGCATTACCCCCCGAGG + Intergenic
1164860470 19:31558520-31558542 GACAAAGGCATTGCCTAGGGTGG + Intergenic
1166443502 19:42837699-42837721 GAGAATGGCATGGACCCAGGAGG - Intronic
1166860614 19:45808749-45808771 GAGAATGGCATGGACCCAGGAGG - Intronic
925124013 2:1440942-1440964 GATCTAGTCATTGCCACAGGAGG + Intronic
925223753 2:2163640-2163662 GAGAAAGGCATGAACCCAGGAGG + Intronic
925583526 2:5438915-5438937 GAAAATGGCATGGACCCAGGAGG + Intergenic
927973674 2:27322164-27322186 GATAAAGGCATTGCCCCAGGAGG - Intronic
928108546 2:28488714-28488736 GATAAAGAGATTTCCCCAGCTGG + Intronic
928304191 2:30152988-30153010 GAGAAAGGCATGAACCCAGGAGG - Intronic
928402366 2:30988302-30988324 GATACAGTCTTTGCCCCTGGTGG - Intronic
928403528 2:30996581-30996603 GATAGAGGCATGGGCCCAAGAGG + Intronic
928527732 2:32159485-32159507 GAGAATGGCATGACCCCAGGAGG + Intergenic
930113808 2:47701702-47701724 GAGAATGGCATTAACCCAGGAGG + Intronic
930717232 2:54604491-54604513 GACAGAGCCAGTGCCCCAGGAGG + Intronic
934856037 2:97730963-97730985 GAGAATGGCATGGACCCAGGAGG + Intronic
935312512 2:101799438-101799460 GAGAAAAGGATTGCCACAGGTGG - Intronic
937476513 2:122219988-122220010 GAGAAAGGCATGAACCCAGGAGG + Intergenic
937763499 2:125633009-125633031 GATAATGGCATGAACCCAGGAGG - Intergenic
938531457 2:132191829-132191851 GATAATGGCATGAACCCAGGAGG - Intronic
939493246 2:142900964-142900986 GATACAGGGATTGCAGCAGGTGG + Intronic
939904136 2:147889655-147889677 GAGAATGGCATGGACCCAGGAGG + Intronic
940856443 2:158731978-158732000 GAGTAAGGCAATGCCCCAGGAGG - Intergenic
941037705 2:160585721-160585743 AATAAAGGCACTGCCCCAGTAGG - Intergenic
941438607 2:165505303-165505325 GATAAAGGCATTGCTTGAAGTGG + Intronic
941911041 2:170764940-170764962 GAAAAAAGCATTGCCCCTGGAGG - Intergenic
941945446 2:171091832-171091854 GAGAACGGCATGGACCCAGGAGG - Intronic
944084941 2:195835017-195835039 AACAAAGGCAATACCCCAGGAGG + Intronic
948522818 2:238551452-238551474 GATGCAGGCACTGCACCAGGAGG - Intergenic
948714114 2:239847820-239847842 GAGAATGGCATGGACCCAGGAGG + Intergenic
1169583595 20:7055983-7056005 GAGAATGGCATTGACCCGGGAGG - Intergenic
1170239458 20:14147220-14147242 GATAAATACATTTCCCAAGGTGG + Intronic
1170916561 20:20632112-20632134 GAGAAAGGCATGGACCCAGGAGG - Intronic
1173096964 20:40042924-40042946 GAGAATGGCATGGACCCAGGAGG + Intergenic
1173917700 20:46721217-46721239 CATAAAGGCATAACACCAGGAGG + Intronic
1175189025 20:57198886-57198908 GAGAAAAGCAAGGCCCCAGGAGG + Intronic
1175746479 20:61460547-61460569 GATAAGGGCCTTGGGCCAGGAGG + Intronic
1175760702 20:61560746-61560768 CATGAAGGCAGTGCCCCAGAAGG + Intronic
1176650788 21:9545150-9545172 GAGAAAGGCATGAACCCAGGTGG - Intergenic
1176805379 21:13476257-13476279 GAGAATGGCATGACCCCAGGAGG + Intergenic
1177153606 21:17479490-17479512 GAGAATGGCATGGCCCCGGGAGG + Intergenic
1177415892 21:20793000-20793022 GAGAATGGCATTAACCCAGGAGG + Intergenic
1177678464 21:24333678-24333700 GAGAATGGCATGGACCCAGGAGG + Intergenic
1178436455 21:32563576-32563598 GATAATGGCATGAACCCAGGAGG - Intergenic
1178986911 21:37313213-37313235 GAGAAAGGCATGAACCCAGGAGG - Intergenic
1181422036 22:22808220-22808242 GAGAATGGCATGGACCCAGGAGG + Intronic
1182970531 22:34570513-34570535 GATAAAGTTATTTCCCCAGGAGG - Intergenic
1183072957 22:35409050-35409072 GAGAATGGCATTAACCCAGGAGG - Intronic
1183353709 22:37347577-37347599 GATAAACACACTGCCCCAAGAGG + Intergenic
1184112632 22:42404175-42404197 GGTGCAGGCATTGCCCCGGGAGG + Intronic
949660827 3:6276304-6276326 GAGAATGGCATGACCCCAGGAGG + Intergenic
951256904 3:20460411-20460433 GAGAATGGCATGACCCCAGGAGG - Intergenic
953540441 3:43813267-43813289 GATAGTGGCTTTGCCCAAGGTGG - Intergenic
953554316 3:43931338-43931360 GAGAAAGGCATTCCCCCAGAAGG - Intergenic
953583491 3:44178344-44178366 GATTAAGTCATTGGCCCTGGAGG + Intergenic
953643636 3:44732531-44732553 GGTACAGGCATTGCCCAAGCAGG + Intronic
955158384 3:56440456-56440478 GAGAATGGCATGGACCCAGGAGG + Intronic
958659469 3:97047408-97047430 GATAATGGCATGAACCCAGGAGG + Intronic
963006304 3:140728896-140728918 GAGAATGGCATTAACCCAGGAGG + Intergenic
965369872 3:167848501-167848523 GAGAATGGCATGGACCCAGGAGG - Intergenic
965500449 3:169449467-169449489 GATAAATGGCTTGCCCTAGGAGG - Intronic
967547413 3:190747933-190747955 AATAAAGGCATTTCCTCAAGAGG - Intergenic
967974282 3:195023421-195023443 GAGAATGGCATTAACCCAGGAGG + Intergenic
968028236 3:195461134-195461156 GAGAATGGCATGGACCCAGGAGG + Intergenic
968618837 4:1594411-1594433 GATAGAGGCACTGCCCCCCGGGG + Intergenic
968845181 4:3037021-3037043 GAGAAGGGCATGGCCTCAGGAGG + Intronic
969234912 4:5858914-5858936 GAGAAAAGCAGAGCCCCAGGAGG - Intronic
969475876 4:7422270-7422292 GAGAACGGCATGGCCCGAGGAGG - Intronic
969542994 4:7805371-7805393 GAGAAAGGAAAGGCCCCAGGGGG - Intronic
970132000 4:12881614-12881636 GAGAATGGCATTAACCCAGGAGG + Intergenic
972137841 4:35915079-35915101 AGCAAAGGCATTACCCCAGGAGG - Intergenic
975540279 4:75502448-75502470 GAAAAAGGCATGAACCCAGGAGG + Intronic
977211194 4:94219886-94219908 GTTTAAGGCATTGTACCAGGTGG - Intronic
977989144 4:103420300-103420322 GAGAATTGCTTTGCCCCAGGAGG - Intergenic
982775914 4:159441189-159441211 GAAATAGTCAATGCCCCAGGTGG + Intergenic
983332456 4:166348002-166348024 GAGAAAGGCATGAACCCAGGAGG + Intergenic
986205466 5:5620881-5620903 GAGAAAGGCATGAACCCAGGAGG + Intergenic
986298452 5:6459047-6459069 GATGAAGGCACTTCCCCTGGAGG - Intronic
988461185 5:31439302-31439324 GAAAAAGGGATTATCCCAGGTGG - Intronic
990127199 5:52533155-52533177 GAGAATGGCATGGACCCAGGAGG + Intergenic
990234841 5:53755965-53755987 GAGAATGGCATGACCCCAGGAGG + Intergenic
990587423 5:57225654-57225676 GAGAAACACATTACCCCAGGAGG + Intronic
992538107 5:77732459-77732481 GAGAAAGGCATGGACCCGGGAGG + Intronic
992646761 5:78818705-78818727 GAGAATGGCATGGACCCAGGAGG - Intronic
993361718 5:86985020-86985042 GGTAAAGGCTGTCCCCCAGGAGG - Intergenic
994590332 5:101762632-101762654 GAGAATGGCATGACCCCAGGAGG + Intergenic
994900834 5:105767211-105767233 GACAAATGCCTTGCCTCAGGAGG + Intergenic
995163539 5:109010245-109010267 GAGAATGGCATTAACCCAGGAGG - Intronic
995665996 5:114543275-114543297 GAGAATGGCATTAACCCAGGAGG + Intergenic
997427903 5:133816834-133816856 GAAAAAGTCATGGCACCAGGTGG + Intergenic
997845104 5:137278959-137278981 GATAATAGCATTCCCCCTGGGGG - Intronic
997921588 5:137984856-137984878 GAGAAAGGCATGAACCCAGGAGG - Intronic
1000859177 5:166435744-166435766 GATAAAGCGATGGGCCCAGGTGG + Intergenic
1001091430 5:168744197-168744219 GAGAATGGCATTAACCCAGGAGG + Intronic
1001113044 5:168914226-168914248 GATAAATATATTGCCCAAGGGGG + Intronic
1003252562 6:4443435-4443457 AATAGAGGCATTGACCCATGAGG + Intergenic
1003654814 6:7996786-7996808 GATGAAAGCATTGCTCTAGGCGG - Intronic
1003729799 6:8808559-8808581 GATAATGGCATGAACCCAGGAGG + Intergenic
1004719871 6:18259303-18259325 GAGAAAGGCATGAACCCAGGAGG + Intronic
1004893459 6:20123965-20123987 GAGAATGGCATTAACCCAGGAGG + Intronic
1005477432 6:26221428-26221450 GATAATGCCAGTGACCCAGGAGG - Intergenic
1007290200 6:40780034-40780056 GATAAAGGAATTCAGCCAGGAGG - Intergenic
1008209568 6:48704102-48704124 GAGAAAGGCATGAACCCAGGAGG - Intergenic
1011453236 6:87517976-87517998 GATTAAGCCAATGCCCAAGGAGG - Intronic
1012600638 6:101092467-101092489 CACAAAGGCATTGACCCAGAGGG - Intergenic
1013222928 6:108095520-108095542 GAGAATGGCATTAACCCAGGAGG + Intronic
1014000273 6:116357440-116357462 GAGAAAGGCATGAACCCAGGAGG + Intronic
1015316138 6:131818556-131818578 GAGAATGGCATGGACCCAGGAGG + Intronic
1016949770 6:149567680-149567702 GATAATGACATTACCCCACGTGG + Intronic
1017764297 6:157593938-157593960 GACAAAAGCTTTGCCCCAGTGGG + Intronic
1021322900 7:19233462-19233484 GAGAAAGGCATGAACCCAGGAGG - Intergenic
1022745951 7:33172289-33172311 GAGAATGGCATTAACCCAGGCGG + Intronic
1022890251 7:34689513-34689535 GAGAATGGCATGACCCCAGGAGG + Intronic
1023040497 7:36168666-36168688 GAGAAAGGCATGAACCCAGGAGG + Intronic
1024298144 7:47862747-47862769 GATCAAGGCAGTACCCCTGGAGG + Intronic
1024564909 7:50673049-50673071 GATAATCACCTTGCCCCAGGTGG - Intronic
1024887707 7:54163296-54163318 GTTAAAGGACTTGCCCCAGAAGG - Intergenic
1026273849 7:68859992-68860014 GATAAAGGCATTGGAATAGGTGG - Intergenic
1026841924 7:73674222-73674244 GAGAATGGCATGGACCCAGGAGG - Intergenic
1027670176 7:81086872-81086894 GAGAAAGGCGTGACCCCAGGAGG - Intergenic
1028047347 7:86139298-86139320 GAGAATGGCATTGACCCGGGAGG - Intergenic
1029019007 7:97344479-97344501 GAGAATGGCATGACCCCAGGGGG + Intergenic
1029681234 7:102112329-102112351 GAGAATGGCATTAACCCAGGAGG - Intronic
1030531565 7:110717373-110717395 GAGAAAGGCATGAACCCAGGAGG + Intronic
1030923785 7:115426074-115426096 GAAAAAGGCATCTCCTCAGGTGG - Intergenic
1033568878 7:142607298-142607320 GAGAATGGCATTAACCCAGGAGG + Intergenic
1040353046 8:46587718-46587740 GATAAAGGCATTACCCCCTGAGG + Intergenic
1040534465 8:48296562-48296584 GAGAATGGCATGGACCCAGGAGG - Intergenic
1041213404 8:55575703-55575725 GAGAAAGGCATGAACCCAGGAGG + Intergenic
1041430655 8:57777678-57777700 GATCAAGCCATTGCTCCAGAGGG + Intergenic
1043365704 8:79531209-79531231 GATAATGGCATGAACCCAGGAGG - Intergenic
1049651623 8:143772310-143772332 GATCCAGGCCTTGCCCCTGGGGG - Intergenic
1050269403 9:3926318-3926340 GAGAATGGCATGACCCCAGGAGG - Intronic
1050528276 9:6564712-6564734 GCTACAGGCACTGCCCCTGGGGG + Intronic
1053812565 9:41868933-41868955 GATAATGGCATGAACCCAGGAGG - Intergenic
1053904779 9:42830158-42830180 GAGAAAGGCATTAACCCAGGAGG + Intergenic
1054618030 9:67318506-67318528 GATAATGGCATGAACCCAGGAGG + Intergenic
1057246625 9:93460866-93460888 GATAAAAGCTCTGCACCAGGTGG - Intronic
1058911024 9:109520067-109520089 GAGAAAGGCATGAACCCAGGAGG + Intergenic
1060129127 9:121077929-121077951 GAGAAAGACCTTGCCTCAGGGGG + Intronic
1061323283 9:129846012-129846034 GAGAAAGGCATGAACCCAGGAGG - Intronic
1187383022 X:18822596-18822618 GAGAATGGCATGGACCCAGGAGG - Intronic
1188030117 X:25254584-25254606 GGCAAAGGCATTGCCCTAGCAGG - Intergenic
1198029064 X:132737479-132737501 GATAAAGGGAGGGCCCCAGTGGG - Intronic
1198427603 X:136535640-136535662 GAGAAAGGCACTTCCCCAGGAGG + Intronic
1198594724 X:138223696-138223718 GAGAAAGGCATGAACCCAGGAGG + Intergenic
1200656923 Y:5913064-5913086 GATAATGGCATGAACCCAGGAGG + Intergenic
1201593062 Y:15636813-15636835 GCTTAAGGCATTGACACAGGTGG + Intergenic