ID: 927975790

View in Genome Browser
Species Human (GRCh38)
Location 2:27337138-27337160
Sequence TCCTGTCCTTCCCCTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927975790_927975791 20 Left 927975790 2:27337138-27337160 CCAGCATCAGGGGAAGGACAGGA 0: 1
1: 0
2: 5
3: 45
4: 305
Right 927975791 2:27337181-27337203 ACATTCATTTTTCTTGTTTCTGG 0: 1
1: 0
2: 7
3: 80
4: 864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927975790 Original CRISPR TCCTGTCCTTCCCCTGATGC TGG (reversed) Intronic
900335569 1:2161342-2161364 TCCTGCCAGGCCCCTGATGCTGG - Intronic
900418083 1:2544129-2544151 CCCTGCCCTACCCCTGATGCAGG + Intergenic
900834433 1:4989394-4989416 TCCTGAACTTCCCCTGATGCAGG + Intergenic
902299884 1:15494177-15494199 TCATGACCATCCCCTGATTCCGG + Intronic
902418348 1:16256735-16256757 TCCTATCCTTCCCCCAAAGCTGG - Exonic
903102172 1:21040170-21040192 CCCTCTCCTTCCCCTGAGGTTGG - Intronic
904292711 1:29498107-29498129 TCCTGTCCTTCCCTTGCCCCAGG - Intergenic
904477338 1:30773813-30773835 TCCTTTCCTTTCCTTGATGGGGG - Intergenic
904916063 1:33971462-33971484 TCAGGTCTTTCCCCTGATCCTGG + Intronic
905405123 1:37727278-37727300 TCCTGTCCTCACCCTGTAGCAGG + Intronic
905508052 1:38495813-38495835 TCTTCTCCTTCCCCTCAGGCTGG + Intergenic
906614076 1:47223258-47223280 TGCTCTCCTACCCCTGGTGCTGG + Intronic
909761148 1:79288965-79288987 CCCTGACCTTACCCTGAAGCAGG + Intergenic
911732864 1:101308314-101308336 TGTTGGCCTTCCCCTGAAGCAGG + Intergenic
913237381 1:116796585-116796607 TTCTCACCTTCCCCTGAAGCAGG - Intergenic
917245770 1:172998701-172998723 TCCTGTCATTACCCTCATGCTGG + Intergenic
917648061 1:177048272-177048294 TCCTTATCTTCCCCTGATTCAGG + Intronic
918191843 1:182183221-182183243 GCCTGGGCTTCCCTTGATGCTGG + Intergenic
919812008 1:201414637-201414659 TCCTGTCCAGAGCCTGATGCTGG - Exonic
920040020 1:203089639-203089661 ACCTGTCCATACCCTGATGGGGG + Intergenic
924710406 1:246526516-246526538 TCCTTTCCTGACCCTGAAGCTGG - Intergenic
1062908365 10:1195173-1195195 CCCTGTCCTTCCCCAGGTCCTGG + Intronic
1066986878 10:42475903-42475925 GCCTGTCCTTCCTCTGCCGCCGG - Intergenic
1067088643 10:43255530-43255552 TCCTGTCCTGCTCCAGGTGCAGG - Intronic
1068162618 10:53285079-53285101 ACATGTCCTTCAGCTGATGCAGG + Intergenic
1068443814 10:57095111-57095133 GCCTGGCCTCCCCCTGCTGCAGG + Intergenic
1069555421 10:69394634-69394656 GCCTGTCCTCCTCCTGATCCTGG - Intronic
1070578803 10:77703096-77703118 CTCTGTCCTTCTCCTGGTGCTGG - Intergenic
1070918562 10:80169962-80169984 GCACTTCCTTCCCCTGATGCAGG + Intronic
1070959746 10:80490302-80490324 TCCAGCCCTTCCTCTGATGGTGG - Intronic
1071891915 10:90018464-90018486 TCCTTTCCTTCCCCAGATATGGG + Intergenic
1073873722 10:107897087-107897109 TCCTGTTCTTACACTGATACTGG - Intergenic
1075770253 10:124928325-124928347 TCCTCACCTTCCCCTGGGGCTGG + Intergenic
1075923337 10:126231557-126231579 TCCTCTCCTTGCCCTGGCGCAGG + Intronic
1077797872 11:5509887-5509909 TCCCGTCCTTCTCTTTATGCAGG + Exonic
1080430576 11:32195233-32195255 TCCTGTTCTGCCTCTGTTGCAGG - Intergenic
1080871719 11:36242357-36242379 TTCTGTTCTTCCCCTGAGTCTGG - Intergenic
1083309000 11:61775100-61775122 TCCTGTCCATCCCCTGGTCTGGG + Intronic
1083333527 11:61910192-61910214 ACCTGCCCTTCCCCTGCAGCGGG - Intronic
1085183329 11:74554605-74554627 TTCTGACCTTCCCCTGCAGCAGG + Intronic
1086002010 11:81995864-81995886 TTCTGTGTTTCCCTTGATGCAGG + Intergenic
1088891558 11:114048750-114048772 TCCTTCCCTTCTCTTGATGCAGG + Intergenic
1089602225 11:119623213-119623235 TCCTGCCCTTCCTCTCCTGCTGG - Intergenic
1090765844 11:129875568-129875590 TCCTCTACCTTCCCTGATGCCGG + Intronic
1090962907 11:131572979-131573001 TCCTCTCCAGCCCCTTATGCTGG - Intronic
1091238063 11:134034748-134034770 TGCTGGCCTCCCTCTGATGCTGG + Intergenic
1091274733 11:134342553-134342575 GCCTGCCCTTCCCCTGCCGCGGG + Intronic
1091740317 12:2956603-2956625 TCCTCTCCGTCCCCTGAACCTGG + Intergenic
1092572963 12:9745369-9745391 TCCTGTGCTTCCACAGAAGCCGG + Intergenic
1097388188 12:58975999-58976021 TCCTGTCCTGTCCCTGAGGCAGG - Intergenic
1097407821 12:59212588-59212610 TCCTCTTTTTTCCCTGATGCAGG + Intergenic
1097503298 12:60433739-60433761 TTCTGACCTTCCCCTGAAGCAGG + Intergenic
1097734073 12:63162987-63163009 TTCTGCCCTTACCCTGAAGCAGG + Intergenic
1099838689 12:87939078-87939100 TCCTGCCCTTCCCATCATCCAGG + Intergenic
1100049439 12:90428663-90428685 TTCTGCCCTTCCCCTGATGAGGG - Intergenic
1100342896 12:93698049-93698071 TTCTGACCTTCCCCTGAAACAGG - Intronic
1100443708 12:94641553-94641575 TCCTGTCTTTCCCCTAGTGTTGG + Intronic
1101307770 12:103546794-103546816 TTCTGACCCTCCCCTAATGCAGG + Intergenic
1102279483 12:111607688-111607710 TCCTTTCCCTCCCCAGAGGCTGG - Intergenic
1102736111 12:115161178-115161200 TCCTGTTCTTACCCTGCTACAGG - Intergenic
1103443805 12:120981128-120981150 TCCTTTCCTGACCCTGACGCTGG - Intronic
1103556314 12:121768786-121768808 TCCTAGGCTGCCCCTGATGCTGG + Intronic
1105444374 13:20439980-20440002 TTCTGCCCTTCCCATGAAGCAGG + Intronic
1106471958 13:30064111-30064133 TTCTGACCTTCCCCTGAGGCAGG - Intergenic
1106860533 13:33902800-33902822 TCCTGTCATTCCCTTGCTCCAGG + Intronic
1106949453 13:34866878-34866900 TTCTGACCTTCCCATGAAGCAGG + Intergenic
1107045017 13:35984740-35984762 TTCTATCATTCCCCTGATCCAGG + Intronic
1107384621 13:39894529-39894551 TTCTGACCTTCCCCGGATGCAGG - Intergenic
1107445787 13:40469488-40469510 TCCTTTTCTTCCCTTGATGTTGG - Intergenic
1108804370 13:54135698-54135720 TTCTGACCTTCCCCTGAAGCAGG + Intergenic
1108887027 13:55199490-55199512 TCCTATCATGCCCCTGTTGCAGG + Intergenic
1109936952 13:69299553-69299575 TCCTTACCTTGCCCTGTTGCTGG + Intergenic
1110224065 13:73101505-73101527 TCCACTCCTTTCCCTGCTGCAGG + Intergenic
1111085747 13:83373441-83373463 TCCTGTCTTTCCCTTAATGGTGG + Intergenic
1112443214 13:99440241-99440263 CCCTGACTTTCCCCTGAAGCAGG + Intergenic
1113397399 13:109961341-109961363 CTCTGTCCATCTCCTGATGCTGG + Intergenic
1113534296 13:111052002-111052024 TTCTGACCTTCCCCAGAAGCAGG + Intergenic
1113580073 13:111422266-111422288 TCCTGCCCTTTCCCTTTTGCAGG - Intergenic
1113944494 13:114036218-114036240 CTCTGACCCTCCCCTGATGCAGG - Intronic
1117416633 14:55502423-55502445 ATCTGACCTTCCTCTGATGCAGG - Intergenic
1118056031 14:62080824-62080846 TCCTGTCCTGTTCCTGTTGCAGG - Exonic
1118909946 14:70053192-70053214 TGCTGTCCTTCCTCTAGTGCTGG + Intronic
1119918759 14:78426743-78426765 TTCTGACCTTCCCCTGAAGCAGG - Intronic
1121669227 14:95695216-95695238 TGCTGTCCTTCACCTGCTGGTGG + Intergenic
1122611436 14:102985971-102985993 TCCTGTTCTTTCCCTGCTGGCGG + Intronic
1126166782 15:45660219-45660241 TCCTGTCCTCCCCCTGAAACAGG - Intronic
1126359423 15:47830912-47830934 TCCTGTTCTTCCCCTGACACCGG - Intergenic
1126894900 15:53247646-53247668 TCCTGTCCTTTGCCTGTTGGGGG + Intergenic
1127580677 15:60336702-60336724 TCGTGTCCTTCTCCTGATTGAGG - Intergenic
1128060491 15:64732437-64732459 TCCTCTCTTTCCCCGGAGGCTGG - Intergenic
1129326533 15:74802919-74802941 TCCTGTCCTGCCCGTGAGGGTGG + Exonic
1129660458 15:77550235-77550257 ACCTGTGCTGCTCCTGATGCTGG - Intergenic
1129966532 15:79740809-79740831 TCTTGACCTTTCCCTCATGCTGG - Intergenic
1130100109 15:80886923-80886945 TTCTGACTTTCCCCTGAAGCAGG - Intronic
1130402166 15:83567485-83567507 TCCTTTCCTTCCTCTGACTCAGG - Intronic
1130805287 15:87314299-87314321 GCCTCTCCTTCCCCTGTAGCTGG - Intergenic
1131066167 15:89436155-89436177 CTCTGTCCTTCCTCTGGTGCAGG - Intergenic
1132771803 16:1567685-1567707 TCCTTCCCTTCCGCTGGTGCGGG - Intronic
1132873266 16:2124846-2124868 TCCTGTCCTGCCCCTGCCGAGGG - Intronic
1133022831 16:2974376-2974398 TTCTGTCCTTGTCATGATGCTGG - Exonic
1133285424 16:4688474-4688496 TCCTGCCCTTGCCCTGGTTCCGG - Intronic
1133792142 16:9017246-9017268 TCGTGTCCCTCCACTGATCCAGG - Intergenic
1134510839 16:14845656-14845678 TCCTGTCCTTCTCTTCATGATGG + Intronic
1134552353 16:15144025-15144047 TCCTGTCCTGCCCCTGCCGAGGG - Intergenic
1134698480 16:16244143-16244165 TCCTGTCCTTCTCTTCATGATGG + Intronic
1134973354 16:18550535-18550557 TCCTGTCCTTCTCTTCATGATGG - Intronic
1136614934 16:31393027-31393049 TCCTGTCCTTCCACTCCTGTGGG + Intergenic
1137474780 16:48798273-48798295 TCCTGTTCTTCCCCAGCTCCAGG - Intergenic
1138214050 16:55187467-55187489 TCCTGGGCTTCCACTGTTGCAGG + Intergenic
1138257569 16:55580069-55580091 CCCAGTCTTTCCCCTGAGGCTGG + Intronic
1138356322 16:56383879-56383901 TCCTGTCAGTCCCCTGGTGGTGG + Intronic
1139287426 16:65827964-65827986 TCTTGTCCTTCCTCTTGTGCAGG + Intergenic
1139828309 16:69775270-69775292 TTCTGACCTTCCCCTGAAACGGG - Intronic
1141681123 16:85544581-85544603 CCCTGTCTTTCCCCTCATGCTGG - Intergenic
1142966233 17:3583532-3583554 GTGTGTCCTTCCCCTGATGGAGG - Intronic
1143118680 17:4594519-4594541 TCCTGTCCTCTCCCTCCTGCCGG - Intronic
1143516625 17:7422464-7422486 TCCTCCCCCTCCCCTGAGGCAGG + Intergenic
1144097839 17:11917859-11917881 TCCCCTTCTTGCCCTGATGCCGG + Intronic
1144221485 17:13103844-13103866 TTCTGACCTTCCCCTGAAGCAGG - Intergenic
1144293849 17:13854618-13854640 TTCTGACCTTCCCCTGAACCAGG - Intergenic
1144674637 17:17153948-17153970 TTCTGCCCTTCCCCCGAGGCTGG + Intronic
1144759354 17:17698592-17698614 TCCTGTCCTGACCCTGAGGCTGG - Intronic
1147976409 17:44250535-44250557 TCCTGTCCCTCCCCTCCAGCTGG - Exonic
1148050589 17:44768187-44768209 TCCTGGCCTTCCCCTGCCCCTGG - Intronic
1148735028 17:49860486-49860508 CCCCGCCCTTCCCCTGATGGTGG - Intergenic
1148764150 17:50027707-50027729 TCCTGCCCCTCCCCTGCTTCCGG + Intergenic
1149164589 17:53735912-53735934 TCCAGTTCTTGCCCTCATGCAGG - Intergenic
1149216983 17:54369174-54369196 TACTGTCCTGCCCATGTTGCTGG + Intergenic
1150438925 17:65176138-65176160 TCTTTCACTTCCCCTGATGCAGG - Intronic
1152391699 17:80007504-80007526 GCCTGTCCGTCCCCAGCTGCTGG - Intronic
1152647175 17:81474798-81474820 TCCTCTTCTTCCCCTGCTGTTGG + Intergenic
1152792988 17:82292411-82292433 CCCAGTCCTTCCCCTGCGGCTGG + Intergenic
1154077186 18:11214876-11214898 TCCCGTTCTTCCCCTGATCTGGG - Intergenic
1156738026 18:40286873-40286895 TTCTGTTCTTCCCCTGAAGCAGG + Intergenic
1157135540 18:45050724-45050746 TCCTGTCATTTTTCTGATGCTGG - Intronic
1157281226 18:46347499-46347521 TCGTGTCCTCCCTCTGAAGCGGG + Intronic
1158133002 18:54173781-54173803 TCCTTTCCTCCCCGTGATACTGG - Intronic
1160031813 18:75268583-75268605 TCCTTTCATTCCCCTGATTTAGG - Intronic
1160225169 18:77006483-77006505 GCCTGTCCATCCCGTGCTGCAGG - Intronic
1160599651 18:80002930-80002952 TCCTGTCCCTCACCTGTTGCTGG - Intronic
1160660262 19:294898-294920 TCCTTGCCTTCACCAGATGCTGG - Intergenic
1161305227 19:3563765-3563787 TCCAGTCCTGTCCCTGATGAGGG - Intronic
1161675385 19:5644844-5644866 TCCTGTCCTCACCCTCATGCTGG + Intronic
1162955862 19:14097540-14097562 CCCTCCCCTTCCCCTGAGGCCGG - Intronic
1162990890 19:14301427-14301449 TCCAGTGCTCCTCCTGATGCAGG - Intergenic
1164189351 19:22900753-22900775 TCATGTCCTTCCACTGAAGTTGG - Intergenic
1164576198 19:29406915-29406937 TCCTGTCACCCCCCTGCTGCAGG + Intergenic
1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG + Intergenic
1165561861 19:36687231-36687253 TCCTGTCCCTGCTCGGATGCGGG - Intergenic
1166746369 19:45143724-45143746 TCCTGTCCTGCCCATCCTGCAGG + Intronic
1166884626 19:45952873-45952895 TCCTGTCGTTGCCCTGAGGTGGG - Intronic
1167070797 19:47221190-47221212 TCCTGGCCACCCCCTGATGAAGG + Exonic
1167854338 19:52225965-52225987 TTCTGTCTCTCGCCTGATGCTGG + Exonic
1168633549 19:57976003-57976025 TCCTGTCCCTCCCAAAATGCTGG + Intergenic
925525182 2:4792309-4792331 TCCTGTCTTTCCCCTTTTCCTGG - Intergenic
927975790 2:27337138-27337160 TCCTGTCCTTCCCCTGATGCTGG - Intronic
929555815 2:42925037-42925059 GCCTGCCATTCCCCTGCTGCAGG + Intergenic
930165466 2:48199476-48199498 GCATTTACTTCCCCTGATGCTGG + Intergenic
930331961 2:49996381-49996403 TCCTGTCCTCCTCTTGATTCAGG - Intronic
930409175 2:51001874-51001896 TTCTGACCTTCTCCTGAAGCAGG + Intronic
931061716 2:58536840-58536862 TTCTGACCCTCCCCTAATGCAGG - Intergenic
932438637 2:71717870-71717892 TCCTTACCCTCCCCTGATGGAGG - Intergenic
932470140 2:71949644-71949666 TTCGGCCCCTCCCCTGATGCGGG + Intergenic
934063938 2:88322080-88322102 TCCAGTCCTTCCTCTGATCTAGG - Intergenic
934552064 2:95268720-95268742 ACCTCTCCTTCCACTGATGTGGG + Intergenic
934969844 2:98754488-98754510 GTCTGTCCTTCCCTTGAGGCAGG - Intergenic
935760867 2:106319469-106319491 TTCTGACCTTTCCCTGAAGCAGG + Intergenic
936095406 2:109527360-109527382 TTGTGTCCTTCCCCTGCAGCGGG + Intergenic
936554636 2:113484384-113484406 TTCTGACCTTCCGCTGATGCAGG - Intronic
936881336 2:117254858-117254880 TCCTGTCCTCCCCAGCATGCTGG - Intergenic
937655557 2:124371122-124371144 TTCTGACCTTCCCCTGAAGCAGG - Intronic
938091073 2:128435177-128435199 TTCTGACCTTCCCCTGAGGTAGG + Intergenic
938734558 2:134174714-134174736 TCCTGTGCTTCCCAGGATGTTGG + Intronic
939018592 2:136931513-136931535 TCCTGATCTTTCCCTCATGCTGG + Intronic
941212256 2:162654965-162654987 TCCTCCCCTTCCCCTGTTCCTGG - Intronic
942076207 2:172359190-172359212 TCCTGCCCTTCCCAAGATGGAGG + Intergenic
943226440 2:185185066-185185088 TCCTGGCCTCTCCCTGATCCTGG + Intergenic
944219950 2:197293123-197293145 TCCTGTCCTTCCTCTGTTCATGG + Intronic
945121702 2:206463723-206463745 TCCTGACCTGCCCCTGATCCCGG - Intronic
945811489 2:214554946-214554968 TCCTGGCCTTTTCCTGATCCAGG + Intronic
946529836 2:220559208-220559230 TCCTCCCTTTCCCCTGATTCTGG + Intergenic
946891692 2:224283442-224283464 TCCTGTTCCACCCCTGCTGCGGG + Intergenic
947976449 2:234370556-234370578 CTCTGACCTTCCCCTGAAGCAGG - Intergenic
948004669 2:234597319-234597341 TCCTGTCCTTCAGCTGATGCCGG - Intergenic
948880109 2:240852340-240852362 CACTGTCCTTCCTCTGATCCTGG + Intergenic
1169188909 20:3644608-3644630 CCCTGTCCTGCCCCTGAATCTGG + Intronic
1169752124 20:9005107-9005129 TTCTCTCCTGCCTCTGATGCAGG + Intergenic
1171481735 20:25459999-25460021 TCCTGTCCTTCCCGTGGAGAGGG + Intronic
1172162743 20:32879772-32879794 GTCTGACCTTCCCCTGAAGCCGG - Intronic
1172604579 20:36206123-36206145 TCCTGGGCTTTCCCTGATCCAGG - Intronic
1173160509 20:40648689-40648711 TCCTGTCCTCTCCCTGCTGATGG + Intergenic
1173401412 20:42729450-42729472 TCCTGTTCTTCCCCTATTGTTGG - Intronic
1174174160 20:48634581-48634603 CCCTGTCCTTCCCCTGCCTCTGG - Intronic
1176038361 20:63051306-63051328 TAGTGTCCTCCCCCTGGTGCAGG + Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176289460 21:5036436-5036458 TCCTGCCCATCCCCTGGTGAAGG - Intronic
1177115637 21:17082741-17082763 TTCTGACCTTCCCCTGAAGCAGG - Intergenic
1178913219 21:36693029-36693051 GTCTGTCCTGGCCCTGATGCGGG - Intergenic
1179415235 21:41193180-41193202 TACTGTCCTACCCCTGAGGTAGG + Intronic
1179867770 21:44227151-44227173 TCCTGCCCATCCCCTGGTGAAGG + Intronic
1181539470 22:23565795-23565817 TCCTGTCCCTCCCCTTCCGCAGG + Intergenic
1181862350 22:25828845-25828867 CCCGGTCCTTGCCCTGGTGCCGG - Exonic
1181892591 22:26076839-26076861 TCCTTTCCTTTTCCTGAGGCTGG - Intergenic
1181996279 22:26885400-26885422 TCGTGTCCTTCCACTGAGTCTGG + Intergenic
1182353215 22:29710478-29710500 GCCTGTCCTTCCCCACCTGCTGG + Intergenic
1182712912 22:32333659-32333681 TCCTGGCCCGCCCCTGATGCTGG + Intergenic
1183686206 22:39362670-39362692 TCCTGCCCTTGTCCTGGTGCAGG - Intronic
1184400162 22:44269022-44269044 TCCTGGCCTGTCCCTGATGCTGG + Intronic
949418262 3:3836804-3836826 GCCTGTCTGTCCCCTGTTGCTGG + Intronic
950496469 3:13337110-13337132 TACTGTCCCTCCCCTGCAGCGGG + Intronic
951643630 3:24863541-24863563 TGCTTTCCTTCCCCTAATCCAGG - Intergenic
955202137 3:56861012-56861034 TCCTCTCCTTTCCCTGCAGCAGG - Intronic
957345219 3:78951651-78951673 CCCTGCGCTTTCCCTGATGCTGG - Intronic
959564891 3:107824180-107824202 TCCTGGCCTTGCCCTGAAGCAGG - Intergenic
961075463 3:123977886-123977908 TCATGTCCATTCCCTGCTGCAGG - Intronic
961267280 3:125653769-125653791 TTCTGTCCTTCCTCTAATACTGG + Intergenic
961308223 3:125974630-125974652 TCATGTCCATTCCCTGCTGCAGG + Intronic
961452089 3:127006810-127006832 TCCCATCCTTCCTCTGAGGCTGG - Intronic
961625326 3:128258323-128258345 CCCTGTCCTTCCCACGGTGCTGG - Intronic
961718968 3:128879546-128879568 GCCTCTCCATCCCCTGCTGCGGG + Intronic
962197892 3:133379513-133379535 TGCTCTGCTTCCCCTGGTGCTGG + Intronic
964356981 3:155859895-155859917 TCCTGGCCTTCCACTGATTCTGG - Intergenic
964768796 3:160203380-160203402 TCCTGCCCATATCCTGATGCTGG + Intergenic
965727723 3:171736718-171736740 ATCTGTGCTTCCCCTGAGGCAGG + Intronic
966080297 3:175992039-175992061 TTCTGGCTTTCCCCTGAAGCAGG - Intergenic
968809016 4:2791919-2791941 CCCAGTCCTTCACCTGCTGCAGG + Intergenic
969860047 4:10028519-10028541 TGTTGTCCTTCCTGTGATGCAGG - Intronic
973705553 4:53576474-53576496 CCCTGCCCTTCCCATGAGGCAGG + Intronic
976027237 4:80703884-80703906 TCCTTCCCTTCCCCAGACGCTGG - Intronic
976964316 4:91017199-91017221 TCCCCTCCTTCTCCTGATGAGGG + Intronic
979460913 4:120982215-120982237 CTCTGACCTTCCCCTGAAGCAGG - Intergenic
980458965 4:133080459-133080481 TTCTAACTTTCCCCTGATGCAGG + Intergenic
981747657 4:148067040-148067062 TTCTGTCCCTCCCCTAAGGCTGG + Intronic
983061762 4:163168648-163168670 TTTTATTCTTCCCCTGATGCTGG - Intergenic
984871465 4:184329225-184329247 TTCTGACCTTCTCCTGAAGCAGG + Intergenic
985540129 5:483959-483981 TCCTGTACTTCCCCTCACGGGGG + Intronic
985660357 5:1153951-1153973 CCCTGTCCTTCTCCTGAGCCTGG - Intergenic
985821495 5:2163790-2163812 TTCCATCTTTCCCCTGATGCTGG + Intergenic
986497465 5:8359645-8359667 CACTGGCCTTCCCCTGGTGCTGG - Intergenic
990620320 5:57551948-57551970 TTCTTTCCTTCCCCAGATACAGG + Intergenic
992198175 5:74360126-74360148 TTCTGACCTTCCCCTGCAGCAGG - Intergenic
992644517 5:78799512-78799534 TCTTTTCCTTCCCCTGATGCTGG + Intronic
994617799 5:102128050-102128072 TCCTTTTCTTCCCCTGCTGCTGG + Intergenic
994652199 5:102543057-102543079 TTCTGACCTTCCCCTGAAGAAGG + Intergenic
995085949 5:108109283-108109305 TTCTGACCTTCCCCTGAAGCAGG + Intronic
995191500 5:109323060-109323082 TCCTGACCCTGTCCTGATGCAGG + Intergenic
995440658 5:112188723-112188745 TACTGTCCTGCCCCTGATTTAGG - Intronic
996000388 5:118354928-118354950 TCCTCTCATTCTCCTCATGCTGG - Intergenic
996520231 5:124418099-124418121 TTCTGACCTTCCTCTGAAGCAGG - Intergenic
997460954 5:134052052-134052074 CTCTGACCTTCCCCTGAAGCAGG + Intergenic
997464283 5:134076854-134076876 GCCTGTTCTTCACCTGATGTGGG + Intergenic
998008843 5:138676870-138676892 TCCTCTGCCTCCCCTGAGGCAGG + Intronic
998131529 5:139653810-139653832 TCATTTCCTGCCTCTGATGCTGG + Intronic
998374828 5:141683269-141683291 CCCTCTTCTTCCCCTGAGGCAGG - Intergenic
998397193 5:141826330-141826352 TCCTGACCCTCCCCGGATGGAGG + Intergenic
1000018801 5:157301447-157301469 TCCTGTCCTTCCTTAGAAGCTGG - Intronic
1001173027 5:169439408-169439430 TGCTGTCCCTCCCGTGTTGCAGG + Intergenic
1003899711 6:10642998-10643020 TCCTGACATTCCCATGATACAGG + Intergenic
1003976703 6:11351524-11351546 TCCTGACTTTCCCCTGAAGTAGG + Intronic
1004947933 6:20636095-20636117 TTCTGACCTTCCCCTGAAGCAGG - Intronic
1006606664 6:35262275-35262297 TTCTGACTTTCCCCTGAAGCAGG - Intronic
1006672144 6:35736273-35736295 TCCTTTTCATCCTCTGATGCGGG + Intergenic
1007406535 6:41638896-41638918 TCCTCTCCGTCCCCAGACGCGGG + Intronic
1008085719 6:47242159-47242181 TCCTGAGATTCCCCTGATGGTGG - Intronic
1009293441 6:61913298-61913320 TCCTGTCCTTTGCCTGAGGTGGG + Intronic
1009864542 6:69380316-69380338 TCCCATCCTTCCCATGTTGCTGG - Intronic
1011133206 6:84073062-84073084 TCGTGTCCTTCCCCGAATTCTGG + Intronic
1011277739 6:85645897-85645919 GCCTGGCCTTCCCTTGATTCTGG + Intergenic
1011412535 6:87081066-87081088 TCCTGTCCTTTGCCAGATTCTGG + Intergenic
1012505889 6:99945769-99945791 CCCTTTCCTTCCCCTCATTCTGG - Intronic
1013068183 6:106703917-106703939 TTCTGACTTTCCCCTGAAGCAGG + Intergenic
1017049222 6:150374856-150374878 TCCTGACCCTCCCCTGAGGCAGG - Intronic
1017898190 6:158699499-158699521 ACCAGTCCTGCCCCTGAAGCTGG - Intronic
1019069708 6:169333555-169333577 TCCTGCCCTGCCCCTTATGGCGG - Intergenic
1019580793 7:1761213-1761235 TTCGGTCCTTCCCCTGTTGGTGG - Intergenic
1020983993 7:15109827-15109849 TTCTGACCTTCCCCTTATACAGG + Intergenic
1021839792 7:24713314-24713336 TTCCAACCTTCCCCTGATGCAGG - Intronic
1022127091 7:27368947-27368969 TTCTGACCTTCCCCTGAAGCAGG - Intergenic
1022385361 7:29893765-29893787 TCCTTTCCTTCCCCTGAGGCAGG + Intronic
1022413040 7:30154133-30154155 TCCTGCCCAGCCCCTGCTGCTGG - Intronic
1022560783 7:31346789-31346811 TTCTGACCTTCCCCTGAAGCAGG + Intergenic
1022625342 7:32030638-32030660 TTCTGATCTTCCCCTGAAGCAGG + Intronic
1024656847 7:51458231-51458253 CTCTGGCCTTCCCCTGAAGCAGG + Intergenic
1027469402 7:78554618-78554640 TTCTAACCTTCCCCTGAAGCAGG + Intronic
1027471684 7:78581988-78582010 TCCTGACCTTCCCCTAAAGCAGG - Intronic
1027797831 7:82716031-82716053 TTCTGACCTTCCCCTGAAGTGGG + Intergenic
1028937087 7:96477411-96477433 TCCTGTCCTTCACCTGGTGGAGG + Intergenic
1029057096 7:97758183-97758205 AGCTGACCTTCCCCTGAAGCAGG - Intergenic
1029627736 7:101730817-101730839 TCCTGTCTCTTCCCTGGTGCTGG + Intergenic
1030601211 7:111595269-111595291 TTCTGACCTTCCCTTGAAGCAGG + Intergenic
1030825734 7:114155545-114155567 TCAGGTCTTTTCCCTGATGCAGG + Intronic
1032669791 7:134072465-134072487 TTCTGACCTTCCCCTGAAGCAGG - Intergenic
1032673224 7:134105189-134105211 TTCTGACCTTCCCCTGAAGCAGG + Intergenic
1032673975 7:134111158-134111180 TGCTGACCCTCCCCTGAAGCAGG - Intergenic
1033041538 7:137923722-137923744 TCCTGTGCTTTTCCTGCTGCAGG + Intronic
1033330295 7:140411858-140411880 TCCTGTCCTTCTCCAGATGCAGG + Exonic
1035045080 7:155960245-155960267 TCCTGTCCATCCGCAGAGGCTGG + Intergenic
1035463188 7:159058849-159058871 TCCTTTGCTTTCCCTGATGGTGG - Intronic
1035742286 8:1937626-1937648 TCCTGTCGTTCCCGTTGTGCAGG + Intronic
1037287725 8:17318834-17318856 TCCTCTCCAGCCCCTGCTGCAGG + Intronic
1038557060 8:28529166-28529188 TCCTGGACCTCCCCAGATGCTGG + Intronic
1039026777 8:33267268-33267290 TTCTGACCTTCCCTTGAAGCAGG + Intergenic
1040566939 8:48575991-48576013 TCCTGTCCTTCCCCAAGTGCTGG + Intergenic
1040586131 8:48743531-48743553 TGCTTTCCTTCCCCTGAAGGTGG - Intergenic
1041587746 8:59541748-59541770 TTCTGACCTTCCCCTGAAGCAGG - Intergenic
1042420346 8:68581382-68581404 TTCTGACCTTCCCCTGAAGCAGG - Intronic
1042839400 8:73108554-73108576 TCCTGTCCCACCCATGGTGCTGG - Intronic
1044234280 8:89812459-89812481 ACCATTCCTTCCCCTGATGGAGG + Intergenic
1044820583 8:96153475-96153497 GCCTGCCCTTCCCCTGGGGCCGG + Intronic
1046365587 8:113226741-113226763 TCTTTTCCTGCCCCTGAAGCAGG + Intronic
1047740264 8:127800997-127801019 GCCTGTCCTTCCCCTACTTCAGG - Intergenic
1048300281 8:133246248-133246270 TCCTGACCTTCCCCGGCTGTGGG + Intronic
1048437803 8:134433867-134433889 TCCTCTCCTTCCTCTCCTGCTGG - Intergenic
1049050052 8:140187662-140187684 TCCTGGCCTTTCCCTGTTGGTGG + Intronic
1049281712 8:141752898-141752920 TCAAGTCCTTCCCCTGAGGGTGG + Intergenic
1049854038 8:144850555-144850577 CCCTGCCCTTCCCATGAGGCAGG - Exonic
1049898376 9:132801-132823 TTCTGACCTTCCGCTGATGCAGG + Intronic
1050506219 9:6352091-6352113 TTCTGACCTTTCCCTGAAGCAGG + Intergenic
1051087155 9:13363137-13363159 TTCTGGCCTTCGCCTGAAGCAGG + Intergenic
1051437179 9:17045121-17045143 CACTGTCCTTCCCCAGATACAGG - Intergenic
1052142478 9:25004154-25004176 CCCTGTCCTGCCACTGCTGCTGG - Intergenic
1053538793 9:38952106-38952128 TTCTGACCTTCTCCTGAAGCAGG - Intergenic
1053741439 9:41143102-41143124 TTCTGACCTTCCGCTGATGCAGG + Intronic
1054346652 9:63972589-63972611 TTCTGACCTTCCGCTGATGCAGG + Intergenic
1054444429 9:65299249-65299271 TTCTGACCTTCCGCTGATGCAGG + Intergenic
1054485843 9:65722252-65722274 TTCTGACCTTCCGCTGATGCAGG - Intronic
1054627347 9:67411813-67411835 TTCTGACCTTCTCCTGAAGCAGG + Intergenic
1054686909 9:68288199-68288221 TTCTGACCTTCCGCTGATGCAGG - Intronic
1054914129 9:70480218-70480240 TCCTGTCCTTCCTCTTCTGATGG + Intergenic
1055123520 9:72691724-72691746 TCCTGTCCATGCCCTGAGACTGG + Intronic
1056434244 9:86559927-86559949 ACCAGTCCTTACCCTGATGTGGG + Intergenic
1057466903 9:95322476-95322498 TTCTGAACTTCCCCTGAAGCAGG - Intergenic
1057547985 9:96032202-96032224 CCCTGGCCTTTCCCTGATGAAGG - Intergenic
1057877636 9:98770081-98770103 TCAGGTCCCTCCCATGATGCGGG - Intronic
1059343613 9:113613479-113613501 TCCTGTCCTGTCGGTGATGCTGG + Intergenic
1061168407 9:128937918-128937940 TCCATTCCTTCCCCTGATAGTGG + Intronic
1061496458 9:130977649-130977671 TCCTGTCCAACGCCTGTTGCTGG - Intergenic
1062703243 9:137919127-137919149 TCCTGCCCATCCCCTCCTGCGGG - Intronic
1187088235 X:16064903-16064925 TTCTGACCTTCCCCTGAAGCAGG + Intergenic
1187405087 X:18996686-18996708 TCCTGACCTGCCCCAGGTGCTGG + Intronic
1189607726 X:42697737-42697759 TCCTGCCCTTCCCCTTCTCCAGG - Intergenic
1189765703 X:44369960-44369982 CTCTGACCTTCCCCTGAAGCAGG + Intergenic
1190227659 X:48558812-48558834 TCCTCTCCTTCTACTGAAGCCGG - Intronic
1192369146 X:70499105-70499127 GCCTGTCCTACCCCTGAGTCTGG - Intronic
1192496794 X:71621614-71621636 TCATGTCCTTCCCAGGTTGCTGG + Intergenic
1196179026 X:112670397-112670419 ACTTGTCCTTCCCCTCATTCAGG - Intronic
1196465588 X:115968906-115968928 GCCTTTCCTTTCCCTGACGCTGG - Intergenic
1196555295 X:117078256-117078278 GTCTGTCCTTCCCTTGAGGCGGG + Intergenic
1197464062 X:126782155-126782177 TCCTGTCCTTTCCCTCACTCTGG + Intergenic
1197708711 X:129651646-129651668 TCCTGTCCTCCCCCTGACTGTGG - Intronic
1199769005 X:150961966-150961988 TCCTGTCCACCCCCTGATAGTGG + Intergenic
1200136758 X:153879018-153879040 TCCTCTCCTCCCACTGCTGCTGG + Intronic
1200694728 Y:6348984-6349006 CCCTCTCCTTCCCCTTATGATGG + Intergenic
1201040549 Y:9825726-9825748 CCCTCTCCTTCCCCTTATGATGG - Intergenic
1201369240 Y:13243118-13243140 TCCTCTGCTTCCCATGCTGCTGG - Intergenic
1202063456 Y:20912547-20912569 TTTTGTCCTTCCCTTGAGGCAGG - Intergenic