ID: 927976194

View in Genome Browser
Species Human (GRCh38)
Location 2:27340182-27340204
Sequence TTCTGTGTTCTCTCACATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927976194 Original CRISPR TTCTGTGTTCTCTCACATAA TGG (reversed) Intronic
900668830 1:3836405-3836427 CTCTGTGTACTTACACATAAAGG - Intronic
900846422 1:5105919-5105941 TTCTGTGGTCTCTCACAGTTAGG - Intergenic
900855103 1:5175089-5175111 TTCTGGGTTCTCTTTTATAAGGG - Intergenic
902142240 1:14366571-14366593 TTGTGTGTTCCCTCCCACAAGGG - Intergenic
903102098 1:21039312-21039334 TTCTGTGTTCTCTCACAGAATGG - Intronic
907406326 1:54255685-54255707 TTCTATTTTCTCTGACATGAAGG - Intronic
908513716 1:64871289-64871311 GTGTGTGATCTCACACATAATGG + Intronic
908710323 1:67007324-67007346 CTCTGGGATCTCTTACATAAGGG + Intronic
909324281 1:74330299-74330321 TTCTGTCTTCTCTACCAGAAAGG + Intronic
909678395 1:78263658-78263680 ATCTGTGATCACCCACATAAAGG + Intergenic
910846020 1:91605432-91605454 TTCTATGTTTCCTCACATAGTGG - Intergenic
913517995 1:119621703-119621725 TTCTTGGATTTCTCACATAAAGG + Exonic
915783543 1:158581590-158581612 TTTTCTGTTCTCTTACCTAAGGG + Intergenic
916012768 1:160721003-160721025 TACTGTGATCTGGCACATAAAGG + Intergenic
918125130 1:181576888-181576910 TTCTGTCATCTCTAAAATAAGGG - Intronic
918999001 1:191803660-191803682 TTGTGTGTTCTCACTCATATAGG - Intergenic
922144618 1:222927966-222927988 TCTTGTGTTCTTTCACAAAATGG - Intronic
924281653 1:242443960-242443982 TTCTGTGTCTTCTCACCTAATGG + Intronic
924500568 1:244634449-244634471 TTCTGTGTTCTCCCACATGTAGG + Intronic
924546931 1:245037052-245037074 TTCAGAGTTCTCTCACCAAAAGG + Intronic
924906644 1:248460909-248460931 TTATGTGCTCTATCACATATTGG - Intergenic
924917466 1:248587240-248587262 TTCTGTGCTCTATCACATATTGG + Intergenic
1063006916 10:1980797-1980819 TTCTGTCTTCTTCCACAGAATGG - Intergenic
1064073867 10:12253293-12253315 TTATGAGTTATCTCACTTAACGG - Intergenic
1064493142 10:15881532-15881554 CTCTGTTATCTCTCACAGAATGG - Intergenic
1064762468 10:18635446-18635468 TTCTGTATTCTCTGTTATAAAGG - Intronic
1066583084 10:36901734-36901756 TTCTGTCTTCTGTGTCATAATGG + Intergenic
1067189550 10:44057807-44057829 TTCTGTGTTTTCTCCTTTAAGGG - Intergenic
1068118760 10:52762850-52762872 TTCTGTGTTTTCTCATAGAATGG + Intergenic
1069418411 10:68223637-68223659 TTCTGTGTTCTGTTACGTGATGG + Intergenic
1069764330 10:70842198-70842220 TTCAGTATTCTCTAACAAAAGGG - Intronic
1071342117 10:84658879-84658901 CTCTGTGTACTCTCAGCTAAGGG + Intergenic
1072507293 10:96081147-96081169 TTCTGTTTTCTCTGAGAAAACGG + Intergenic
1073276148 10:102313336-102313358 TTTTGTTTTCTTTCACGTAAGGG - Intronic
1073605270 10:104888559-104888581 TTCTATGTTGACTCAAATAAAGG + Intronic
1074071920 10:110079998-110080020 TTCTGGGTTCTATCCCAAAACGG - Intronic
1075312694 10:121428146-121428168 TTCTGTGTTCTCACATTCAAAGG + Intergenic
1077887088 11:6394425-6394447 TTCTGGTTTCTCTACCATAAGGG + Exonic
1079273945 11:19016114-19016136 TTCTCTGTTTTCTCATATGAAGG - Intergenic
1079983707 11:27178335-27178357 TTCTGTGTTCTGTCACACCAGGG - Intergenic
1079985333 11:27194029-27194051 TTCTGTATGATCTCAAATAAGGG + Intergenic
1080076370 11:28154824-28154846 TTCTCAGTTCTCTCTCACAAAGG + Intronic
1080256581 11:30296955-30296977 ATCTGTGTACTGTCTCATAAGGG - Intergenic
1080326083 11:31075161-31075183 TTCTGAGTTGTATCACTTAATGG + Intronic
1081281883 11:41219512-41219534 TTCTGTGTGTTCCTACATAAAGG + Intronic
1081504433 11:43700563-43700585 TTGTGTGTTCTCTTACTTATGGG - Intronic
1081804670 11:45884003-45884025 TTCTGGCTTCTCTCTAATAATGG + Intergenic
1081986620 11:47309457-47309479 TTCTGTGGTCTCCCACTTGAGGG + Intronic
1082274928 11:50211355-50211377 TTCTGTCTTCTCTGACCTAGTGG + Intergenic
1085045800 11:73352741-73352763 TTCTGTGTGCACTCACACAGGGG + Intronic
1085972790 11:81612893-81612915 ATGTGTGATCTCTCAAATAAAGG + Intergenic
1086805518 11:91236821-91236843 TTCTGAGCTCCCTCACATCATGG + Intergenic
1088119504 11:106351463-106351485 CTCTGGGTTCTCTTTCATAAGGG + Intergenic
1088208012 11:107417063-107417085 TTCTGTGTTATGTCTAATAAAGG - Intronic
1088483357 11:110317608-110317630 TTCTGTGAACTCTAAGATAATGG + Intergenic
1088533060 11:110831282-110831304 GTCTCTGTTCTGTCACAAAAAGG - Intergenic
1089203937 11:116743054-116743076 TGCTGTGTTCTCACACTTACAGG + Intergenic
1090132788 11:124162177-124162199 TTCTGTGTTCTATAATCTAAGGG + Intergenic
1090673109 11:128964604-128964626 TCCTGTTTTCTCTCTCTTAAGGG - Intergenic
1090868525 11:130723102-130723124 TTCTTTGTTCTCTCCCTGAAGGG + Intergenic
1090898476 11:131003215-131003237 TTCTGTTTACTCACACATAGTGG + Intergenic
1091651672 12:2314977-2314999 CTCTGTGTTTTCTTTCATAAAGG - Intronic
1093830994 12:23758225-23758247 ATCTGTATTCTCTCATTTAATGG + Intronic
1097809023 12:63998469-63998491 TTCTCTGTTCTATCACAGATTGG + Intronic
1098237215 12:68428673-68428695 TTCTGTGTTCTCTTATGTGATGG - Intergenic
1100587904 12:95996288-95996310 GTCTGTGTTCTCTGCCATTAAGG + Exonic
1100769810 12:97909481-97909503 GTGTGTGTTCTCCCAAATAAAGG + Intergenic
1102129004 12:110510318-110510340 TTTTGTGATCTACCACATAAGGG - Intronic
1102577866 12:113868045-113868067 TGCTGTGTGCTCTTAAATAAAGG - Intronic
1102814636 12:115854792-115854814 TTCTGAGTTATTTCACTTAATGG + Intergenic
1103184312 12:118943200-118943222 TGCTGTGTGCTCTCACACACAGG + Intergenic
1108906346 13:55479165-55479187 TTCTGTCTTCTCTCTCTTATTGG + Intergenic
1109085764 13:57969421-57969443 TTCTGTGTTCTCTCTGATCTAGG - Intergenic
1109523011 13:63536689-63536711 TTTTGTTTTCTTTCTCATAAGGG - Intergenic
1111974559 13:94951977-94951999 TTCTGGGTTCTCTAACTTTAGGG - Intergenic
1111985072 13:95057712-95057734 TTCTGTGTTCTCTCTCTTCCTGG - Intronic
1112221573 13:97496594-97496616 TTCTGTTTACTCTCACATCAAGG + Intergenic
1112796545 13:103062984-103063006 TTCTGTGTCCTCTCAACTATGGG + Intronic
1115895686 14:38084400-38084422 TTTTGTCTTCTCTCTCATCATGG + Intergenic
1116993636 14:51301092-51301114 TTCTGTGGTCTCTCACGTGCAGG - Intergenic
1117108505 14:52424032-52424054 ATCTGTCTTCTCTGACATTAAGG + Intergenic
1117569625 14:57033875-57033897 TTCTGCCTTCTGTCTCATAACGG - Intergenic
1118086502 14:62424068-62424090 TTCTGTCTTCTTGAACATAAGGG - Intergenic
1120530724 14:85627773-85627795 TAGTGTGTTCTCTCTGATAAGGG + Exonic
1125128564 15:36254208-36254230 ACCTGTGTTCTCTCCCATAAGGG + Intergenic
1125619359 15:41045982-41046004 TTCTCTGTTCTCTGGTATAATGG - Intronic
1126731617 15:51689205-51689227 TTCTGTGATCTATCATAAAAAGG - Exonic
1127660270 15:61094178-61094200 ATTTTTGTTCACTCACATAAAGG - Intronic
1128162326 15:65431773-65431795 TTCTGAGGTCTGTCACAGAAGGG + Intergenic
1128743085 15:70096642-70096664 GTGTGTGTGCTCTCACACAAAGG - Intronic
1134384122 16:13756121-13756143 TTCAGTTTTCTCCCACAGAACGG - Intergenic
1136040275 16:27573102-27573124 TTCTGAGTGCTCTTACCTAAGGG + Intronic
1137283513 16:46997894-46997916 TTTTATGTGCTCTCACATAATGG + Intergenic
1137851265 16:51747195-51747217 TTCTGTCATCTCTCACCTAATGG + Intergenic
1139354459 16:66359270-66359292 TTCTGTGCCCTCTCTCAGAATGG + Intergenic
1139731101 16:68946109-68946131 TTGTCTTTTCTCTTACATAATGG + Intronic
1140862062 16:79026573-79026595 CTCTGTGTTCTCTCCCCTAGAGG - Intronic
1144285248 17:13768092-13768114 TTCTGAGTTATTTCACTTAATGG - Intergenic
1146582158 17:34048171-34048193 TTCTGAGTTCTCTCACTTCTAGG + Intronic
1147846478 17:43407485-43407507 TTCTGTCTTCTCTCTCCTTAAGG - Intergenic
1149224610 17:54454647-54454669 TTCTGTGTTCTATAACGTAGAGG + Intergenic
1149308017 17:55368002-55368024 TTCACTGTTCTCCCAAATAAGGG + Intergenic
1150161030 17:62898328-62898350 TCCTGTGCTCTCACAGATAATGG - Intergenic
1153206073 18:2702987-2703009 TTCTGTATTCTCTCCCAACAGGG + Intronic
1155606262 18:27609613-27609635 TTTGGTCTTTTCTCACATAAGGG - Intergenic
1155657909 18:28212057-28212079 GTCAGTGTTTTCTCACGTAAAGG + Intergenic
1155982220 18:32193393-32193415 TTCAGTGTTCTCTCACAGCATGG + Intronic
1158860588 18:61588462-61588484 TGCTATTTTCTCTCAGATAATGG + Intergenic
1164630412 19:29758146-29758168 TGCGGTGTCCTCCCACATAAGGG + Intergenic
1164694095 19:30230583-30230605 CTCTCTGTCCTCTCCCATAATGG - Intronic
1165200620 19:34141426-34141448 TTCTGTGTACTCTCACAGAATGG + Intergenic
1165806278 19:38582970-38582992 GACTGTGTTCTCTCACATCCTGG + Intronic
1167226397 19:48244628-48244650 TTCTGTACTCTGTCACATTAGGG - Intronic
1167981336 19:53278551-53278573 TTCTTTGTTCTCACACAGGAAGG + Intergenic
926903978 2:17788733-17788755 TTCTGATTTCACTCACAGAAAGG - Exonic
927976194 2:27340182-27340204 TTCTGTGTTCTCTCACATAATGG - Intronic
928220416 2:29398607-29398629 TTCTGTGACCTATCACAAAAAGG - Intronic
929288491 2:40163333-40163355 TTGTGTGTTCTCTCCCTTATGGG - Intronic
929585882 2:43114073-43114095 TTCTTTTTTCACTCACATAAAGG - Intergenic
930341559 2:50122454-50122476 TTTTGTGATCTCTCCCATATAGG - Intronic
930928533 2:56851479-56851501 TGCATTGTTCTCTCACATATGGG + Intergenic
933022502 2:77211421-77211443 TTCTCTGTTCTCTCACCCAGCGG - Intronic
933248153 2:79998862-79998884 TTCTGGTTTCTTTCACAAAATGG + Intronic
933442435 2:82330209-82330231 TTCTGTTTTCTTTAACATCAGGG - Intergenic
933527067 2:83455002-83455024 TTCATAGTTCTCTCATATAAGGG + Intergenic
935448432 2:103181410-103181432 TTCTGGGCTCTCTTTCATAAGGG + Intergenic
936638371 2:114285001-114285023 TTCTGTGTCCTATCAGATAGAGG - Intergenic
936966722 2:118134409-118134431 TTCTGTGTGTTCCCACATATTGG + Intergenic
938885317 2:135641101-135641123 TTCTGTGTTCTTATAGATAAGGG + Intronic
939584042 2:143985235-143985257 TTGTGTGCTCCCTCCCATAAGGG + Intronic
940672984 2:156693641-156693663 TTCTCTGTGCTCTCACATGGTGG - Intergenic
941144064 2:161821211-161821233 TTCTGATTTCACTCTCATAATGG + Intronic
941417893 2:165244456-165244478 TTATGTCTTCTTCCACATAAAGG - Intronic
941536478 2:166728424-166728446 TTCTGTGTTCCCTCAACAAAGGG - Intergenic
942642456 2:178073822-178073844 TTCTGTATTCAGTCACATCATGG + Intronic
942666455 2:178324433-178324455 TTCTCTGTTCTCTCTTATAAAGG - Intronic
942912035 2:181255553-181255575 TTCTGTTTTCTCCCACAGGATGG - Intergenic
943830580 2:192455430-192455452 TTCTGTGTTGTATAAGATAAGGG - Intergenic
945299678 2:208204384-208204406 TCCTGTGTTCTCTAACATTCTGG + Intergenic
945954722 2:216076090-216076112 TTCTGTGTCCTCTCAGAAAAAGG + Intronic
946822359 2:223643371-223643393 CTCTGAGTTCTCTCAGATAAAGG + Intergenic
1168901997 20:1372571-1372593 TTCAGTGATCTGTCACTTAAAGG + Intronic
1170326938 20:15166338-15166360 TTCTGTGGTCTCTTTCATAAGGG - Intronic
1170842045 20:19931861-19931883 TTAGGTGTTCTCACAAATAATGG + Intronic
1172296228 20:33812945-33812967 TTCTGTCTTCTCTCCCATTAGGG - Intronic
1173322185 20:41998142-41998164 CTCCGTGTCCACTCACATAAAGG - Intergenic
1176200757 20:63859294-63859316 TCCTGTGGTCTCACACAAAATGG + Intergenic
1176367708 21:6043928-6043950 TGCTGTGTTCTCACCCAGAAAGG - Intergenic
1176805274 21:13475197-13475219 TTGTTTCTTCTCTCACATGAAGG - Intergenic
1177293153 21:19141299-19141321 TTCTTTTTTCTCTAACGTAAAGG - Intergenic
1177446076 21:21197682-21197704 TTCTGTGTTTTCTCTTATGAAGG + Intronic
1178016336 21:28350521-28350543 CTCTGTGCTTTCTCACAAAATGG + Intergenic
1179034235 21:37746060-37746082 ATCTGTGATCTCTCTTATAAGGG + Intronic
1179755811 21:43494614-43494636 TGCTGTGTTCTCACCCAGAAAGG + Intergenic
1182322714 22:29488930-29488952 CTCTGTGTCCACTCACATAAAGG + Exonic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1185202044 22:49513517-49513539 TTCTGTGACCTCTAGCATAATGG - Intronic
949187586 3:1211333-1211355 TTCTGTGTTCTTTTAGATACAGG + Intronic
949456967 3:4249147-4249169 TTCTGTGTTCTCTAGCAGAGTGG + Intronic
949929359 3:9066393-9066415 TTCTGAGTTCTCTGACTTACAGG - Intronic
950368169 3:12504015-12504037 TTTTGTTTTCTCCCAAATAAAGG - Intronic
950759149 3:15205607-15205629 TTATGTCTTCTCTCCCCTAAAGG - Intergenic
951039199 3:17969517-17969539 TTCTCTGATCTCTAGCATAAGGG + Intronic
954020719 3:47738719-47738741 ATCTGTGTTCTCTTAGATAAAGG + Intronic
956702232 3:71968452-71968474 TTCTGTCTTCTCTCGCACTAGGG - Intergenic
956751909 3:72350310-72350332 TTCAGTGTTTTCCCACTTAATGG - Intergenic
957141023 3:76357591-76357613 TTCTATTTTATCTCACATGATGG + Intronic
957964633 3:87306674-87306696 TTCTGGGATTCCTCACATAAGGG + Intergenic
958634837 3:96730575-96730597 TTCTGTGAACTCTCAGATAGTGG + Intergenic
959010967 3:101075868-101075890 TTCTGAGTTATTTCACTTAATGG - Intergenic
961119227 3:124359328-124359350 TTCTATGTTCTAGCACAAAATGG + Intronic
962977890 3:140461834-140461856 TTGAGTGTTGTTTCACATAAGGG - Intronic
964367860 3:155968903-155968925 GACTGGGTGCTCTCACATAATGG - Intergenic
966169233 3:177059276-177059298 TTCTTTGTTGACTCAGATAAAGG - Intronic
966337292 3:178882667-178882689 TTCTGTGTTCTCTACCCTAACGG - Intergenic
967240581 3:187435608-187435630 TGCTGTGTTCTCCAACATTAGGG - Intergenic
967580295 3:191145165-191145187 TTATTTTTTCACTCACATAAAGG + Intergenic
968637162 4:1686506-1686528 ATCTGACTCCTCTCACATAAGGG - Intergenic
969931076 4:10631261-10631283 GTATGTGTCCTCTCTCATAAAGG + Intronic
970480167 4:16464549-16464571 TTATGTGTTCTCTCTCTCAAGGG - Intergenic
970524995 4:16922494-16922516 TACTGTGTTTTCTTAAATAAAGG + Intergenic
972168791 4:36319640-36319662 GTCTGTCGTCTCTGACATAACGG - Intronic
974531253 4:63110721-63110743 TCATGTGTTCTCACTCATAAGGG + Intergenic
974750522 4:66134648-66134670 TTCTGTGTGTTCTCACATAGTGG + Intergenic
974796800 4:66763117-66763139 TACTTTGTTCTATCACACAAAGG + Intergenic
974874684 4:67688531-67688553 TTCTGAGTTCTCTCTCTCAAAGG - Intronic
975282562 4:72578597-72578619 TTCTGTGTTCTCTTGCTTCAAGG + Intergenic
975516187 4:75250947-75250969 TTCTGTAGTCTCTCACTTAAAGG - Intergenic
977740081 4:100469202-100469224 TTGTGTGTTGTGTCAAATAAGGG - Intronic
977880501 4:102198977-102198999 CTCTGTGGTCTCTTTCATAAGGG + Intergenic
978453124 4:108858688-108858710 CTCTGTGTTCTTCCACATTATGG - Intronic
978469209 4:109043975-109043997 TTCTATTTTCTTTCTCATAAAGG - Intronic
979797214 4:124861270-124861292 TTCTGGGGTCTCTTTCATAAGGG + Intergenic
979926027 4:126565622-126565644 TTGTGTGTTTTCTCTCATACTGG - Intergenic
984785475 4:183563697-183563719 TTCTGTCTTCTCCCACTAAAGGG - Intergenic
986796575 5:11218511-11218533 GTGTGTGTTCTCTCAAATAAAGG + Intronic
987451550 5:18090427-18090449 TTCTGTGTGTCGTCACATAATGG + Intergenic
987996148 5:25282489-25282511 TTCTGTCTTCTTTCAAGTAATGG + Intergenic
988658880 5:33242390-33242412 TGCTGTTTCCTCTCACATTATGG - Intergenic
989174537 5:38510328-38510350 TTCTTTGTTCTTTAATATAAAGG - Intronic
989476108 5:41874960-41874982 TTCTCTGTGTCCTCACATAATGG + Intergenic
990322452 5:54643221-54643243 TTCTACATACTCTCACATAATGG + Intergenic
990396616 5:55387779-55387801 TTCTGTGTTTTCTCATCCAATGG + Intronic
992992284 5:82296596-82296618 TTGTGTGTTCTTTCAAATAATGG + Intronic
993181946 5:84564367-84564389 ATCTGTGTTTTCTTACAAAAAGG + Intergenic
993465061 5:88235264-88235286 TTCTGTGTTTGCTCACATTTAGG - Intronic
993782291 5:92082294-92082316 TTCTGTGTTTTTTCACTTCAAGG - Intergenic
994771018 5:103981674-103981696 CTCTGTGGTCTCTGTCATAAGGG - Intergenic
994913432 5:105943269-105943291 TCCTGTGCTCCCTCTCATAAGGG - Intergenic
995273679 5:110252877-110252899 TTCTGTGTTCTATTACATCCAGG - Intergenic
995385357 5:111582579-111582601 TTCTTTGTTATCTCACTGAATGG - Intergenic
996016940 5:118549859-118549881 TTTTGTTTTCTCTCCCATATTGG - Intergenic
996064161 5:119063663-119063685 TTCTGTGTTGCCAGACATAATGG + Intronic
996771123 5:127086800-127086822 GTCTGTGTTCAATCACATCATGG + Intergenic
998219704 5:140266664-140266686 TTCTGTGTTGACTCACCTGAGGG - Intronic
999765656 5:154738721-154738743 ATCTGTGTCCTATCTCATAAGGG - Intronic
1000056643 5:157612799-157612821 TGCTGCATACTCTCACATAATGG - Intergenic
1000171695 5:158708514-158708536 CTCTGTGTTCTGCCCCATAAAGG - Intronic
1003784458 6:9468785-9468807 TTCTGTATTTTCCCACATTATGG + Intergenic
1004906060 6:20238398-20238420 TTGTGTGCTCCCTCCCATAAGGG - Intergenic
1005880865 6:30059755-30059777 ATCTGTGTTCTCTGACCTCAAGG - Intronic
1006833509 6:36983311-36983333 ATCTGTGTTCTCTTAAATACAGG + Intronic
1007065871 6:38989990-38990012 TTTTGTTTTCTCTCACATACAGG + Exonic
1009649648 6:66458373-66458395 GTCTATGTTCTCTCCTATAAAGG - Intergenic
1012206451 6:96466659-96466681 TCCTGGGCTTTCTCACATAATGG - Intergenic
1012375031 6:98551889-98551911 TTCTCTTTTCTCCCACATAAAGG + Intergenic
1012756801 6:103241631-103241653 TTCTGAGTTATTTCACTTAATGG - Intergenic
1013336731 6:109171110-109171132 TTCTTTGTTCTTTTACAGAATGG + Intergenic
1015487178 6:133786205-133786227 ATCTGTGGTCTCTCACAGACTGG + Intergenic
1015671584 6:135697090-135697112 TTCTTTGTCCTCTTTCATAAAGG + Intergenic
1016449965 6:144172374-144172396 GTCTGAGCTTTCTCACATAATGG + Intronic
1020250364 7:6463428-6463450 TTCTGGGTACTATAACATAAAGG + Intronic
1020846279 7:13288389-13288411 TTGTGTGTTCTCACTCATATGGG + Intergenic
1023271603 7:38469360-38469382 TTCTTTGTTCTCAGAAATAAAGG + Intronic
1026576851 7:71579069-71579091 GTCTTTGTTCTCTCACCTATTGG + Intronic
1027340061 7:77197582-77197604 TTCTATTTTCTTTCACCTAAAGG + Intronic
1027602507 7:80256624-80256646 CTCTTTCTTCTCTCAAATAAAGG + Intergenic
1028482073 7:91317862-91317884 TTTGGTTGTCTCTCACATAAAGG + Intergenic
1028572536 7:92306595-92306617 TCTTGTGTTCTCTCACATGGTGG - Intronic
1030787799 7:113684266-113684288 TTATGTGTTCCCTCCCACAAGGG - Intergenic
1031304659 7:120111160-120111182 TTCTGAGTTGTCTCACTTAAGGG + Intergenic
1032084314 7:128875966-128875988 TGCTCTGTTCTCTCACGGAATGG - Intronic
1032586405 7:133151206-133151228 TCCTGTGGTTTCTCACATCATGG - Intergenic
1033584205 7:142762260-142762282 TTCTGTGTAATCTAACCTAAGGG - Intronic
1033693530 7:143762443-143762465 TGCTATGTTCTCTCAGTTAAGGG - Intergenic
1034096665 7:148415111-148415133 TTCTCTGTTCTCAGACATCATGG + Intronic
1037371415 8:18183605-18183627 TTCTGTGTTCCCTTACAGAACGG + Intronic
1038296520 8:26296389-26296411 TTCTATGCTCTCTCACTTTAGGG + Intronic
1038358698 8:26855914-26855936 TGCTGTGTTCTGTCACCTCATGG - Intronic
1038419211 8:27421529-27421551 TTGTATGTTCTCACTCATAAGGG - Intronic
1039238330 8:35527488-35527510 TTCTTTGTGCTCTCACATTAGGG + Intronic
1039533794 8:38289033-38289055 TTGTGGGTTCTCTGAAATAAAGG + Intronic
1041553444 8:59125786-59125808 TTCTGTGTTTTCACATATCAGGG - Intergenic
1042447424 8:68902621-68902643 TTCTGAGTTGTTTCACTTAAAGG - Intergenic
1043736324 8:83749886-83749908 TTCTGAGTTATTTCACTTAATGG + Intergenic
1044369272 8:91389898-91389920 TTCTCTGTTCTCTCAGGCAATGG + Intronic
1044425305 8:92043050-92043072 TTCTCATTTCTCTCACATGAAGG + Intronic
1045475669 8:102550278-102550300 TTCTCTGTCCTCTCAAAAAAAGG - Intergenic
1045600869 8:103714163-103714185 TTCTATGTTTTGGCACATAATGG + Intronic
1047064759 8:121268649-121268671 ATTTGTGTTATCTCACATACTGG + Intergenic
1048641533 8:136368802-136368824 TTGTGAGGTCACTCACATAAAGG - Intergenic
1052778162 9:32754058-32754080 TTCTGTGTCCTCTCTCCTAGGGG - Intergenic
1053122050 9:35554992-35555014 TTCTGGGTTTTCTCTCATATGGG + Intronic
1054933586 9:70663154-70663176 TTGTATGTTCTCACTCATAAGGG + Intronic
1057864912 9:98672389-98672411 TTCTGTGTTCTCACTTAAAAGGG - Intronic
1059573730 9:115468140-115468162 TTGCGTGTTCCCTCCCATAAGGG - Intergenic
1059815296 9:117905401-117905423 TTCTGGTTTCTCTCACCTCAAGG + Intergenic
1059931612 9:119266248-119266270 TTCTGCGTTCACTCACAGCATGG - Intronic
1186038608 X:5451572-5451594 TTTTGAGTTCTATCACATTATGG + Intergenic
1186124268 X:6395979-6396001 TCCTCTCTTCTCTCACTTAATGG + Intergenic
1186170557 X:6872044-6872066 TTCTGGGGTCTCTTTCATAAGGG + Intergenic
1186404586 X:9290802-9290824 TTCTGGGCTGTCTCACATACCGG - Intergenic
1186756727 X:12679233-12679255 TTTTGTGTTCTCTTACATGGTGG + Intronic
1188095646 X:26018194-26018216 ATCTGTGTTCTCTGAAAAAATGG + Intergenic
1188096262 X:26027124-26027146 TTCTGCATTCTCACTCATAAAGG + Intergenic
1188362113 X:29267846-29267868 TTCTGGGTTCTGTGAGATAATGG - Intronic
1188619552 X:32203308-32203330 TTCCTTATTCCCTCACATAAAGG + Intronic
1189842032 X:45090201-45090223 TACTTTGTTTTCTCTCATAAGGG - Intronic
1190004399 X:46721302-46721324 TTGTGTGTTCTCTACCATTATGG - Intronic
1190690208 X:52907568-52907590 TTCTGACTTCTGTCACCTAATGG - Exonic
1190695775 X:52948224-52948246 TTCTGACTTCTGTCACCTAATGG + Exonic
1191683761 X:63868123-63868145 TTCTGTATTGTCTCACATGTGGG + Intergenic
1193098493 X:77579858-77579880 TTTTGTGTTCTCTCTCTGAAAGG - Intronic
1193139720 X:78014975-78014997 TTCTGTGTTATCTCTAAAAAAGG + Intronic
1193883754 X:86960097-86960119 TGCTGTGAACACTCACATAAAGG - Intergenic
1193907355 X:87260052-87260074 TTCTGTTTTCTCTCATTTGAGGG + Intergenic
1195461306 X:105128479-105128501 TTCTCTGCACTCTCACTTAATGG + Intronic
1196682721 X:118485136-118485158 TTCTGAGTTGTTTCACTTAATGG + Intergenic
1196742507 X:119037587-119037609 TTCTGAGTTGTTTCACTTAATGG + Intergenic
1197004791 X:121482396-121482418 TTCTGTGTGTTCTCACATGGTGG + Intergenic
1197621022 X:128748371-128748393 TTGTATGTTCTCACTCATAATGG - Intergenic
1197664137 X:129204930-129204952 CTCTATGTTCTCACTCATAAGGG - Intergenic
1198463970 X:136888311-136888333 CTCTGTGGTCTTTTACATAAAGG - Intergenic
1198493993 X:137172059-137172081 TTCAGTGTTCTCTGAAATAACGG - Intergenic
1198529343 X:137535006-137535028 TACTGTGTTGTATAACATAAAGG + Intergenic
1199191143 X:144972591-144972613 CTCTGGGTTCTCTTTCATAAGGG - Intergenic