ID: 927978136

View in Genome Browser
Species Human (GRCh38)
Location 2:27356097-27356119
Sequence GAGGCAACTCACTTTGTTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927978136_927978142 17 Left 927978136 2:27356097-27356119 CCTCCAACAAAGTGAGTTGCCTC 0: 1
1: 0
2: 1
3: 5
4: 124
Right 927978142 2:27356137-27356159 CCACCTCTGACTTCCCCAACAGG 0: 1
1: 0
2: 1
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927978136 Original CRISPR GAGGCAACTCACTTTGTTGG AGG (reversed) Exonic
900800305 1:4733112-4733134 GGGGCTGCCCACTTTGTTGGAGG - Intronic
902140398 1:14349071-14349093 GAGGCAACTCTCATTGTTCTTGG + Intergenic
905707583 1:40073234-40073256 GAGTCAACTTACTCTGTTGCTGG - Exonic
906934353 1:50198992-50199014 GGGTCAACTCACTTGGTTGGAGG + Intronic
907630469 1:56076529-56076551 GAGTCAACATACTTTGTGGGAGG - Intergenic
908235164 1:62141180-62141202 GAGGCAAATCACCTTGTGTGAGG - Intronic
910021204 1:82591790-82591812 GGTGCAGCTCACTTGGTTGGTGG - Intergenic
911419891 1:97627461-97627483 GTGGCAACTCACTCTGTTTCAGG + Intronic
919212732 1:194509551-194509573 AGGGAAACTCACTTTTTTGGCGG - Intergenic
923397974 1:233586197-233586219 AAGGAAACACACATTGTTGGTGG + Intergenic
1064117323 10:12589667-12589689 GAAGCTACTCCCTGTGTTGGAGG - Intronic
1067058735 10:43066906-43066928 GAGGCAGCCCTCTTTTTTGGGGG - Intergenic
1070566043 10:77604691-77604713 TAGGCAACTCTTTTTTTTGGGGG - Intronic
1071974451 10:90940785-90940807 GAGGAATCTCAACTTGTTGGGGG - Intergenic
1074025022 10:109625500-109625522 GAGGCAGCTCACTTTGGTCAAGG - Intergenic
1077133584 11:987326-987348 AAGGAAACTCACTTTGTTCGGGG + Intronic
1077155222 11:1088116-1088138 GAGGCAGCCCACCTTGTAGGAGG - Intergenic
1078519892 11:12054223-12054245 GAGGGAAATCACTATGTTGAAGG - Intergenic
1079206482 11:18419514-18419536 GAGGAAACTCACTTTATTTCAGG + Intronic
1080747699 11:35123474-35123496 GAGGAAATTCTCTTTGTTGATGG + Intergenic
1086169444 11:83819122-83819144 GCGGGAACTCCCTTTGTTGATGG - Intronic
1086551220 11:88054678-88054700 GAGGCCACTAACTTTGTTCAGGG + Intergenic
1087872480 11:103313649-103313671 GAGGCAACTGACGCTTTTGGGGG - Intronic
1092704958 12:11272165-11272187 GAGGCAACTCAATTTGCTAAAGG - Intergenic
1097808581 12:63992522-63992544 GAGGCAGCTCCCTTTGGTGGAGG + Intronic
1099154640 12:79158976-79158998 GAGGCAACACAGTTTGTTCAAGG + Intronic
1101207430 12:102502657-102502679 GAGAAAACACACATTGTTGGTGG + Intergenic
1102328826 12:112012641-112012663 GAAGGCACGCACTTTGTTGGGGG - Intronic
1105912727 13:24886139-24886161 GATTCACCTCACTTTGTTGTTGG - Intronic
1108513973 13:51180073-51180095 GAGGCAACTCCGTGTCTTGGAGG + Intergenic
1112265485 13:97919801-97919823 GAGGCAACTCACAGTGTAGTGGG - Intergenic
1115206676 14:30914284-30914306 AAGGAAACTGACATTGTTGGTGG - Intronic
1118687306 14:68303599-68303621 GAGGCAAGTCACTTTGGGGTGGG + Intronic
1122655274 14:103254587-103254609 GAGGCATCTCACTTTGCTGGTGG - Intergenic
1130819261 15:87476893-87476915 TAGGCAACTCATTTTGATGTTGG - Intergenic
1132269172 15:100507942-100507964 GAGGCAACTCACATCATTGAAGG - Intronic
1132393761 15:101457515-101457537 GATGCAGCTCCCTTTGTGGGGGG + Intronic
1134411832 16:14009741-14009763 GATAAAACTCACGTTGTTGGGGG - Intergenic
1135898490 16:26432532-26432554 GAGGCTAGTGACTTTGTTAGAGG - Intergenic
1143332526 17:6148278-6148300 GAGGCTAGACACTTTGTGGGGGG - Intergenic
1144137720 17:12314424-12314446 CAGCCAAAGCACTTTGTTGGGGG + Intergenic
1146538212 17:33671698-33671720 GAGTCAAATCACATTGCTGGGGG + Intronic
1147406788 17:40218192-40218214 CAGGGAACTCACTACGTTGGTGG - Intergenic
1147460153 17:40563192-40563214 CAGGCAACTCTCATTGTTTGAGG - Intronic
1150604214 17:66676983-66677005 CAAACAACTCACTGTGTTGGTGG + Intronic
1151420173 17:73991751-73991773 AAGGCAAGTCACATTGTTTGGGG - Intergenic
1151924050 17:77180622-77180644 GAGGCAGCTGACTTTGGTTGAGG + Intronic
1152937191 17:83146107-83146129 GAGGCACGTCCCTGTGTTGGAGG + Intergenic
1156076329 18:33283019-33283041 GAGGCAATGCAGCTTGTTGGAGG - Intronic
1158482672 18:57835788-57835810 GTGGCAACTCACATTGATAGTGG - Intergenic
1158872230 18:61699236-61699258 GAGGAAACTCACATTGATGAGGG - Intergenic
1161728816 19:5946448-5946470 GAGGCCCCCCACTTTGTTGCAGG - Intronic
1163457882 19:17419361-17419383 GAGGTAACTCGGTTTGCTGGTGG + Exonic
1166932202 19:46308295-46308317 CAGGGAACTCACTCTGCTGGGGG - Exonic
927978136 2:27356097-27356119 GAGGCAACTCACTTTGTTGGAGG - Exonic
929836367 2:45404435-45404457 GTGGAAACTCACTGTATTGGAGG - Intronic
930216400 2:48701621-48701643 GAGAAAACTCATTTGGTTGGGGG - Intronic
931334807 2:61328714-61328736 GAAGTTACTCACTTTGTTAGTGG - Intronic
932344251 2:70985351-70985373 GTGGCAATTCACGTTGTGGGTGG + Intronic
935831037 2:107000685-107000707 GAGGCCACTCTCTTTGTGGTAGG + Intergenic
945768289 2:214007650-214007672 GAGGCAGATCACTTTTTTGAGGG - Intronic
945947133 2:216005236-216005258 CATAGAACTCACTTTGTTGGTGG - Intronic
1172706153 20:36883518-36883540 GATGCCATTCACTTTGATGGGGG - Intronic
1174474760 20:50788738-50788760 GAGGAGAGTCACTTAGTTGGAGG - Intergenic
1175287136 20:57844534-57844556 GAGGCATCTCACGTGGTTTGTGG + Intergenic
1178735717 21:35148340-35148362 GAGGCCACCCACTTAGTTTGGGG - Intronic
1181919382 22:26308548-26308570 CAGAGAACTCACTTTTTTGGGGG - Intronic
1183415557 22:37679767-37679789 GAGGCAGCTGCCTTTATTGGGGG - Exonic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
952304883 3:32136874-32136896 GAGGCAACCCACTGTCTTGAGGG + Intronic
961033295 3:123624974-123624996 AAGGGAAATCACTGTGTTGGAGG - Intronic
962919455 3:139937085-139937107 CAGGCAAATTACTTTTTTGGGGG + Intronic
964211205 3:154230213-154230235 TAAGCCACTCACTTTGTTTGTGG - Intronic
965208319 3:165750685-165750707 GAGTAAACTCATTTTGGTGGTGG + Intergenic
967793339 3:193572256-193572278 GGGGAAACTGACTTTGTTTGGGG + Intronic
972678976 4:41287446-41287468 GAGTGAACTGACTCTGTTGGTGG - Intergenic
972944998 4:44243178-44243200 GAGGCAACTTCCTTTGTTCATGG + Intronic
974786772 4:66628258-66628280 AAGGCAATTTACTTTGTTGAAGG + Intergenic
975184079 4:71380717-71380739 GAGGTCACTCAGTTAGTTGGGGG + Intronic
977140660 4:93367324-93367346 GAGGCAACTAAATTTGATGATGG - Intronic
979702915 4:123688407-123688429 GAGACATCTCACATTGTGGGAGG + Intergenic
979960549 4:127015753-127015775 AAAGCATCTCACTTTGTTCGAGG - Intergenic
982628242 4:157796417-157796439 GAGGCAACTCAATTTTTTTAAGG - Intergenic
983019645 4:162659741-162659763 GAGGCAACTGACTTTGAAAGGGG + Intergenic
983740205 4:171121526-171121548 GAGGCTTCGCACTTTGATGGGGG + Intergenic
984144405 4:176043946-176043968 GAGGCAACACAGCTGGTTGGGGG + Intergenic
985563824 5:605269-605291 GAGGCACCTCACATTGTGAGAGG + Intergenic
985563830 5:605310-605332 GAGGCACCTCACATTGTGAGAGG + Intergenic
985563899 5:605650-605672 GAGGCACCTCACATTGTGAGAGG + Intergenic
989063990 5:37441176-37441198 GAGGCAAGTGAGTTTGTAGGTGG + Intronic
989260882 5:39418898-39418920 GAGGCAACTCATTTTCCTGATGG + Intronic
994417800 5:99497006-99497028 GAGGCAAGTGAGTTTGTAGGTGG + Intergenic
994462165 5:100078150-100078172 GAGGCAAGTGAGTTTGTAGGTGG - Intergenic
994809021 5:104489143-104489165 GAGTCAGCTCTCTGTGTTGGCGG - Intergenic
995836834 5:116407732-116407754 GAGGTCACTCACTTAGTAGGTGG - Intronic
997467961 5:134100754-134100776 GAGGCACAGCACTTTCTTGGAGG - Intergenic
997778963 5:136638064-136638086 GAATGAAGTCACTTTGTTGGTGG - Intergenic
1007422779 6:41729484-41729506 GAGGACCCTCACTTTGTTGAAGG - Intronic
1007619353 6:43202713-43202735 CAGGCAGCTCACTTTGCTGGTGG + Exonic
1009584776 6:65586035-65586057 GTGGCCACTCACTTATTTGGTGG + Intronic
1011866075 6:91829748-91829770 GGGAAAACTCTCTTTGTTGGAGG - Intergenic
1012493854 6:99812805-99812827 GAGGAAGCTTACTGTGTTGGTGG - Intergenic
1012961586 6:105627892-105627914 GAAGCAACTCACTTTTTCTGGGG - Intergenic
1014138369 6:117913689-117913711 GTGGCAACTCAGTTAGTTAGTGG + Intronic
1021404010 7:20243088-20243110 GAGGAAACTCATTTTTTTGTAGG - Intergenic
1021554265 7:21903804-21903826 GAGGGAAATCACTTTGCTGAAGG + Intronic
1022162471 7:27725546-27725568 GATGCTACTCACTTTGGTGCTGG + Intergenic
1028073315 7:86479111-86479133 GAGGCAAGTTACTTGGGTGGGGG - Intergenic
1029645708 7:101854541-101854563 GAGGCACCTCACTTTATGGAGGG - Intronic
1030509236 7:110464343-110464365 GAGGGAAGGCACATTGTTGGAGG - Intergenic
1030700647 7:112635982-112636004 AAGGCAACTTACTTTCATGGAGG - Intergenic
1033245188 7:139711984-139712006 GAGGCAAGTCTCTGTGGTGGTGG + Intronic
1034114869 7:148575794-148575816 GAGCCACATCTCTTTGTTGGAGG - Intergenic
1034607202 7:152328057-152328079 GAAGACACGCACTTTGTTGGTGG - Intronic
1036935721 8:13000554-13000576 GATACAACTAACTTTGCTGGGGG - Intronic
1037202095 8:16267799-16267821 GTTGAAACTCACTTTGTTGTTGG + Intronic
1038003858 8:23413476-23413498 GAGGAAACTCACTGTGTATGAGG - Intronic
1045066480 8:98451347-98451369 GAAGCAGTTCAGTTTGTTGGCGG + Intronic
1047021563 8:120780236-120780258 GAGGCAAGCCAATTTGGTGGTGG - Intronic
1050779604 9:9315559-9315581 GATGAAATTCACTTTTTTGGGGG + Intronic
1056031965 9:82562254-82562276 GAGACACCTCACTTTGCTGCAGG + Intergenic
1060494391 9:124107316-124107338 GAGGCAACTCACTGTGTCTTGGG + Intergenic
1060496979 9:124126121-124126143 GAGGCAAGTGACTTGCTTGGAGG + Intergenic
1185662572 X:1738986-1739008 GAGGCCAATCACTTTGGAGGGGG - Intergenic
1186938093 X:14473311-14473333 TAGGCACCTCAATTTGTTAGAGG - Intergenic
1194832266 X:98638218-98638240 GAGACAACTCAGTATGTTGGTGG + Intergenic
1195868237 X:109456810-109456832 GAGGCAATTCCCTTTGCTGAAGG - Intronic
1196890360 X:120285387-120285409 GAGGCAAGTCACTGTGTAGCTGG + Intronic
1200763620 Y:7062283-7062305 TAGGCTACGCCCTTTGTTGGAGG - Intronic
1200870133 Y:8088801-8088823 GAGACACCTCACTTTGGTGCTGG + Intergenic
1202592477 Y:26500924-26500946 GAGGCTGCTCCCTTTGATGGTGG - Intergenic