ID: 927980447

View in Genome Browser
Species Human (GRCh38)
Location 2:27371322-27371344
Sequence GCTCCTGGGGCTGCACGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927980439_927980447 29 Left 927980439 2:27371270-27371292 CCTATAACATTCACGTGAATGGA 0: 1
1: 0
2: 1
3: 6
4: 88
Right 927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG 0: 1
1: 0
2: 0
3: 37
4: 355
927980442_927980447 4 Left 927980442 2:27371295-27371317 CCTGCACTGTCGGGTGCGCTACA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG 0: 1
1: 0
2: 0
3: 37
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927980447 Original CRISPR GCTCCTGGGGCTGCACGAGC AGG Exonic
900013316 1:133662-133684 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900064818 1:724646-724668 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900126061 1:1069425-1069447 GCTCCTGAGGCGGCTCGCGCTGG - Intergenic
900392883 1:2441355-2441377 GCTCCTGGGCCTGCACTGGGAGG + Intronic
900544362 1:3220308-3220330 GGTCCTGGGGCTGCCCTGGCCGG - Intronic
900978080 1:6029603-6029625 GCAGCGGGGGCTGCAGGAGCTGG - Intronic
902097805 1:13960841-13960863 TCTCCTGGGGCTTCAGGACCTGG + Intergenic
902283003 1:15388211-15388233 GCTCCTTGGGCAGCGCGTGCAGG - Intronic
902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG + Exonic
903185609 1:21627166-21627188 GATCCTGGGGCTGGGCAAGCAGG + Intronic
904206824 1:28860962-28860984 CCTCCTGGGGCTGGACCAGATGG + Intronic
904853776 1:33479555-33479577 GATCCTGGAGCTGCTCGTGCTGG + Exonic
905473491 1:38209810-38209832 GCACCTGGGGATGCAGAAGCTGG + Intergenic
907509756 1:54949419-54949441 GCTCCTGGGCCAGCATGTGCAGG - Intergenic
908351177 1:63287068-63287090 GATCCTGGGTCTGCAGGAGCTGG - Intergenic
909445528 1:75744280-75744302 GCTTTTGGGGCTGCAGCAGCAGG + Intronic
910744823 1:90562044-90562066 CCTCCTGGAGATGCTCGAGCAGG + Intergenic
913513924 1:119586759-119586781 GCCCCTGGGGCTGCAAGGGATGG - Intergenic
913517601 1:119617734-119617756 GCCCCTGGGGCTGCAAGGGATGG - Intergenic
913531155 1:119735250-119735272 GATCCTGGTGCTGCCCCAGCAGG + Intronic
914463940 1:147909500-147909522 GCTGCTGGGGTTGGAGGAGCGGG - Intergenic
914678973 1:149925928-149925950 CCTCCTGGGGCTGCAGGACATGG - Exonic
914912988 1:151801792-151801814 GCTCCTGGAGCCGCACCAGGGGG + Exonic
914917518 1:151827713-151827735 CTTCCTGGGGCTTCAGGAGCTGG + Intronic
915616566 1:157043936-157043958 GCTCCTAGGGTTGCACTAGGGGG - Intronic
916555379 1:165890230-165890252 GCTCCTGGGGCAGAATGAGGTGG + Exonic
917139815 1:171824729-171824751 GCAGCTGGTGCTGCACCAGCAGG - Intergenic
918181409 1:182088171-182088193 GTGCCTGGGGCTGCAGGAGGCGG + Intergenic
919920920 1:202165961-202165983 TCTCCTGGGCCTGCCCCAGCAGG - Intergenic
921262910 1:213399679-213399701 GCTCCTGGGACTGAAAGAGCAGG - Intergenic
922099723 1:222470665-222470687 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922261757 1:223950160-223950182 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922565335 1:226597894-226597916 GCTACTGGGGCAGCCAGAGCAGG + Intronic
922735323 1:227975585-227975607 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
924342922 1:243052332-243052354 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
924694153 1:246382228-246382250 AATCCTGGGGCTACAGGAGCTGG - Intronic
1065057515 10:21861853-21861875 GCCCTTGGGGCTGCTCGATCTGG + Intronic
1065900140 10:30198901-30198923 GCTCTTGGGGCTGCCCTAGGTGG + Intergenic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1066733561 10:38453220-38453242 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1067448154 10:46365628-46365650 GCTCCTTGGACTGCATCAGCAGG + Intergenic
1067656718 10:48197938-48197960 CCTCCTGGGGCTGCTTGACCAGG + Intronic
1067717227 10:48699012-48699034 CTTTCTGGGGCTGCACGGGCCGG - Intronic
1068121401 10:52785278-52785300 GGTCCTGGGACTGCTCAAGCTGG - Intergenic
1068658365 10:59596972-59596994 GCTTCTGGGGCAGCACAACCAGG + Intergenic
1069414778 10:68188658-68188680 TCTCCTGGGGCTGCATGCTCAGG + Intronic
1070703348 10:78619084-78619106 GCTCCTGGGGGTGCAGAAGCAGG - Intergenic
1070948056 10:80409050-80409072 GCACCTGGGGCTGGTCCAGCAGG - Intronic
1072710713 10:97714113-97714135 GCTGCTGGGCAAGCACGAGCTGG + Exonic
1073498817 10:103918112-103918134 GCTCCTGGAGCTGCAGGCGGCGG - Exonic
1073582680 10:104682316-104682338 GGTCCTGGGGCTGCATGGCCTGG + Intronic
1073707185 10:105998261-105998283 AATCCTGGAGCTGCAGGAGCTGG + Intergenic
1074847020 10:117407315-117407337 CCCCCTGGGCCTGCAGGAGCTGG + Intergenic
1076335461 10:129703699-129703721 GCACCTGGGGCTGCAGGATTTGG - Intronic
1076969652 11:125866-125888 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1077184161 11:1228936-1228958 CCTCCGGGGGCTGCAGGAGAAGG + Intronic
1077308026 11:1876546-1876568 GCTCCTGTGGCTGCCCCACCCGG - Intronic
1077332806 11:1990755-1990777 GCCTCTGAGGCAGCACGAGCAGG - Intergenic
1077426926 11:2484939-2484961 GCAGCTGGGGTTGGACGAGCAGG - Intronic
1078492664 11:11783810-11783832 GTTCCTGGCACTGCACGAGGTGG - Intergenic
1078724830 11:13920708-13920730 GCTCCTGGACCTGCTGGAGCTGG + Intergenic
1079125106 11:17713456-17713478 GCTCCTGGAGCTGTAGGGGCTGG - Intergenic
1079430934 11:20387799-20387821 CGGCCTGGGGCTGGACGAGCCGG - Intronic
1081995322 11:47359942-47359964 GCTGCGGGGGCTGCACGCTCTGG + Exonic
1084066217 11:66705765-66705787 CCTGCTGCAGCTGCACGAGCTGG - Exonic
1084652053 11:70495214-70495236 CCTCCCTGGGCTGCACGGGCTGG + Intronic
1084774929 11:71368910-71368932 ACTCCTGGGGCAGCACGTGGCGG + Intergenic
1084909073 11:72373052-72373074 GCTCCAGGGCCTGCAGGACCTGG - Intronic
1085152598 11:74264200-74264222 CTTCCTGGGGCTTCATGAGCTGG - Intronic
1089022223 11:115228133-115228155 GCTCCTGGGACTCCTAGAGCTGG + Intronic
1089375995 11:117995261-117995283 GCTCCGGGGGCTGCTAGATCTGG - Intronic
1091345945 11:134854141-134854163 GCTCCTGGGTCTGCACAGGTTGG + Intergenic
1202815789 11_KI270721v1_random:45931-45953 GCCTCTGAGGCAGCACGAGCAGG - Intergenic
1091381910 12:67239-67261 GCTCCTGGAGCAGCCCCAGCGGG + Exonic
1091569153 12:1669437-1669459 GCACCTGGGGCCCCACGACCTGG + Intergenic
1094841840 12:34345564-34345586 GCCCCGGGGGCTGCACAAGGCGG - Intergenic
1095950300 12:47778128-47778150 ACTCTTTGGGCTGCACCAGCAGG + Intronic
1096503404 12:52079187-52079209 CCTCCTAGGGCTGGACAAGCAGG - Intergenic
1097172909 12:57127743-57127765 GCGCCTAGGGCTGGGCGAGCAGG + Intronic
1100875490 12:98957203-98957225 GCTCCTTGGGCTCCACAAGTGGG + Intronic
1101650536 12:106673381-106673403 CCTCCTGGGACTTCACCAGCCGG - Intronic
1101993824 12:109510393-109510415 GCTTATGGTGCTGTACGAGCGGG + Exonic
1102508186 12:113397268-113397290 GGTCCAGGGGCTGCAGGAGGTGG - Exonic
1104745125 12:131205652-131205674 GCTCCTGGGGATGGAAGGGCCGG + Intergenic
1104789269 12:131471747-131471769 GCTCCTGGGGATGGAGGGGCCGG - Intergenic
1104802541 12:131564376-131564398 GCTCCTGGAGCTGACAGAGCCGG - Intergenic
1106140415 13:27006597-27006619 CCTCCCGGGGCGGCACCAGCTGG + Intergenic
1108355516 13:49625756-49625778 GCTCCTGGGGGTGGGGGAGCTGG - Intergenic
1110260924 13:73484510-73484532 GCTCATGGGGCTGCCTGACCTGG + Intergenic
1112792803 13:103021665-103021687 GCTCCTGGGGCTACAGGCACAGG + Intergenic
1113554042 13:111216767-111216789 GCTCCTGTGCCGGCACGAGCAGG + Intronic
1114267061 14:21078959-21078981 GCTCTTGCTGCTGCACGTGCAGG - Exonic
1118363458 14:65074992-65075014 GCTCCTGGTTCTGCAAGACCGGG + Intronic
1118571525 14:67199858-67199880 CCTCCTGGGGCTGCAGGACATGG + Intronic
1118590944 14:67400533-67400555 GGTCCTGGGGCAGCACTAGCAGG + Intronic
1119470254 14:74892866-74892888 GCTTTTGGGGCTGCAGCAGCAGG - Exonic
1119472710 14:74909594-74909616 GCTGGAGGCGCTGCACGAGCAGG - Exonic
1119733922 14:76968893-76968915 GCAGCTGGTGCTGCACCAGCAGG + Intergenic
1120100059 14:80434791-80434813 ACTCCTGTGGCTGCCCCAGCTGG - Intergenic
1121007773 14:90501196-90501218 GCCCCTGGGGCTGCAGGGCCGGG - Intergenic
1121046376 14:90791236-90791258 GTTCCTGGGGCTGCTCGAGGTGG - Intronic
1121258330 14:92548422-92548444 GTTCCTAGGGCTGCAGTAGCAGG + Intronic
1122092553 14:99349918-99349940 GCACCTGAGCCTGCACGACCTGG + Intergenic
1122151082 14:99726622-99726644 GCGCTTCGGGCTGCAGGAGCAGG + Exonic
1122353740 14:101111681-101111703 GCTCTTGGGGATGAAAGAGCTGG + Intergenic
1122861418 14:104584284-104584306 TTTCCTGGGGCTGCACGGCCTGG - Intronic
1122938266 14:104969914-104969936 TCTCCTGGGGGTGCCCGAGGTGG - Intronic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124426903 15:29570454-29570476 GCTCCGGGGACTGCGCGGGCCGG - Intronic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125282852 15:38061392-38061414 TCACCTGGAGCTGCACTAGCTGG - Intergenic
1127899695 15:63331762-63331784 GCTCCTGGGCCTGCCAGAACAGG - Intronic
1128655139 15:69455233-69455255 GCAGCTGGTGCTGCACCAGCAGG + Exonic
1128661451 15:69504144-69504166 GCTCCTGGGACTTAACGAGATGG + Intergenic
1129032437 15:72628922-72628944 GCTCCTTGGGCTGGACCAGGTGG - Intergenic
1129038671 15:72665980-72666002 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129211220 15:74071250-74071272 GCTGCTGGAGCTGCAAGAGTTGG - Exonic
1129291963 15:74575148-74575170 GCTCCTGGGTTTGCACCAGCTGG - Intronic
1129399183 15:75269837-75269859 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129402790 15:75294113-75294135 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129407202 15:75327659-75327681 GCTCCTTGGGCTGGACCAGGTGG - Intergenic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129728353 15:77915524-77915546 TCTGCTGGAGCTGCAAGAGCTGG - Intergenic
1129734616 15:77952616-77952638 GCTCCTTGGGCTGGACCAGGTGG + Intergenic
1129840974 15:78743375-78743397 GCTCCTTGGGCTGGACCAGGTGG - Intergenic
1131054196 15:89365926-89365948 GTTCCTGGAGCTGCAGGAGGAGG + Intergenic
1132887413 16:2188785-2188807 GCTCCTGGGTGTGCTCGAGGAGG - Intronic
1133218884 16:4309856-4309878 GCCCCTGGGGCTGCACCTCCTGG + Intergenic
1134311252 16:13077096-13077118 GGTCCTGGTGCTGCATTAGCTGG - Intronic
1138782655 16:59807923-59807945 GCTACTGGGGCTCCAGGATCTGG - Intergenic
1139436874 16:66941544-66941566 GCTCCTGGGGGTGCCTGGGCAGG - Exonic
1139824775 16:69748296-69748318 GCAGATGGGGCTGCACGTGCTGG - Exonic
1141154542 16:81588016-81588038 GTTCCTGGGGAAGCAAGAGCCGG - Intronic
1141608718 16:85169710-85169732 GCTCCTGCTGCTGCAGGAACGGG - Intergenic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142003673 16:87679060-87679082 GCGCCTGGGGCTGCAAGATGGGG - Intronic
1142176886 16:88649561-88649583 CCTCCTGGGGCTGCACGGTCTGG + Intronic
1142242059 16:88952045-88952067 GCTCCTGGGGCTGCTGGGGCCGG - Intronic
1142425085 16:89998021-89998043 TCTCCTGGGGCTGCCAGACCAGG + Intergenic
1142451024 16:90173256-90173278 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1142456539 17:60439-60461 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1142475110 17:184076-184098 GCTCTTGGCTCTGCAGGAGCTGG + Intergenic
1142631397 17:1228874-1228896 GTTCCTGCGGGTGCCCGAGCGGG - Intronic
1143075572 17:4339961-4339983 CAGCCTGGGGCTGCACGGGCTGG + Intronic
1143656366 17:8295860-8295882 TCTCCTGAGGCTGCACGGGTTGG + Intergenic
1145252288 17:21303179-21303201 GCTCCAGGGCCCGCACGATCTGG - Exonic
1145769450 17:27482284-27482306 GGCCCTGGGGTTGCAGGAGCAGG + Intronic
1148356268 17:46977999-46978021 GATCCTGGGGCTCCACGCGGAGG - Intronic
1148736713 17:49869268-49869290 GCTCCTGGGCCTGGAGGAGGGGG + Intergenic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1150622432 17:66818263-66818285 GAACCTGGGGCTGCTTGAGCAGG + Intergenic
1150765535 17:67998895-67998917 GCTCCTGGGGTGGCACCAGCTGG + Intergenic
1151681432 17:75624772-75624794 GCTGCAGGGGCCGCACCAGCTGG - Intergenic
1151882579 17:76904168-76904190 ACCCCTGGGGGTGCACGTGCGGG + Intronic
1151958562 17:77392998-77393020 GCTCCTGGGGCAGGTGGAGCAGG - Intronic
1152152278 17:78609609-78609631 GCTTCTGTGGCTGTAGGAGCTGG - Intergenic
1152677901 17:81651094-81651116 CCACCTGGAGCTGCACGAGCTGG - Exonic
1153344055 18:4007214-4007236 GCTCCTGGGGCAGCTCCAGGAGG + Intronic
1153981316 18:10313053-10313075 TCTCCTGGGGCTGGACGGGGTGG - Intergenic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1157491328 18:48125782-48125804 TCTCCTGGGGCTGCCCAGGCAGG - Intronic
1158461916 18:57653991-57654013 CCTCATGGGGCTGCTCGACCAGG - Exonic
1160510311 18:79449787-79449809 GGTCCTGGGGCTGCAGGAGTGGG + Intronic
1160646457 19:195792-195814 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1160699171 19:497855-497877 GCTCCGGGGGCTCCACCTGCAGG - Exonic
1160790423 19:920394-920416 GTTCCTGGTGCTGCAGGCGCTGG + Exonic
1160805914 19:992100-992122 GCGCCTGGGCCTCCACCAGCAGG + Exonic
1161483375 19:4521891-4521913 CCTCCTGGTCCTGCAGGAGCTGG - Intergenic
1161953833 19:7482205-7482227 GCTCCTGGTCCTGCAGGAGGAGG - Exonic
1162126499 19:8502347-8502369 GCTCCTGGGGGTTCACGCTCAGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163236857 19:16035062-16035084 GCTCCTGGGACCGCACTAACAGG + Intergenic
1163600375 19:18245616-18245638 GCTCATGAGACTGCTCGAGCTGG - Intronic
1163749226 19:19065283-19065305 GGTCCCGGGTCTGCAAGAGCTGG - Intronic
1163766267 19:19165122-19165144 GGTGCTGGGGATGCAGGAGCAGG + Intronic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164591710 19:29511127-29511149 AGCCCTGGGGCTGCACGGGCAGG + Intergenic
1165041007 19:33067396-33067418 GGTCCTGGGGCAGCACCTGCAGG - Intergenic
1165792266 19:38499564-38499586 GGTCCTGGGGCTGCATGGGGAGG + Intronic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166369354 19:42292634-42292656 CCTCCGGGGGCTGCACAGGCAGG - Exonic
1166695902 19:44851317-44851339 GCTCCTGGGTCTGAGGGAGCAGG - Intronic
1166733735 19:45072422-45072444 GCTCCTGGGCCTGGCCGAGGTGG - Exonic
1167233074 19:48297503-48297525 GCTCCTGGAGCTCCACCTGCAGG + Exonic
1167603153 19:50466130-50466152 CCTCCTGGGGCTTCAGGAGGAGG + Intronic
1167705618 19:51079384-51079406 GCTCCTGGGTCTCCAGGAGGTGG - Intronic
1167724545 19:51201316-51201338 GGACCTGGGGATGCAAGAGCTGG - Intergenic
1168106419 19:54168338-54168360 GCTCCTGGAGCTGCACAGTCAGG + Intronic
1168146874 19:54424554-54424576 GGCCCAGGGGCTGCACAAGCCGG + Intronic
925731717 2:6923711-6923733 GCACCTGGGCCTGCAGGACCTGG - Intronic
925884435 2:8382313-8382335 GCGCCAGGGGCTGCTGGAGCTGG - Intergenic
927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG + Exonic
929242453 2:39666250-39666272 GCTCCTGGGGCTCGGCGGGCTGG + Exonic
930651678 2:53970583-53970605 GCTCTTGGAGCTGCACGGCCCGG + Exonic
932749354 2:74361534-74361556 GCTCCTGGGTCAGCACCAGCCGG + Exonic
935134124 2:100284435-100284457 GCTCCAGGGGCAGCACGGCCAGG + Exonic
937885865 2:126899695-126899717 GCTCCTGGGGATGATCGAGGGGG - Intronic
938015295 2:127862285-127862307 TGTCCTTGGGCTGCTCGAGCTGG - Exonic
938258479 2:129878340-129878362 GCTTCTGGGGCTGGACGACGGGG - Intergenic
938500805 2:131830556-131830578 GGTCCTGGGGCTGCACCCTCTGG + Intergenic
939441833 2:142260290-142260312 GCTCCTGGGGCAGTACCAGAGGG - Intergenic
942465231 2:176201020-176201042 GCAGCTGGTGCTGCACCAGCAGG - Intergenic
942558703 2:177198447-177198469 GCTGCTGTGGCTGAAGGAGCTGG - Intergenic
943718543 2:191178906-191178928 ACCCCTGGGGCAGCACGTGCAGG + Intergenic
943718996 2:191183162-191183184 GCTCCAGGGGCTGCCTGAGGTGG - Intergenic
945062885 2:205924208-205924230 GCTCCTGGGCCTGGGGGAGCGGG + Intergenic
945796806 2:214374635-214374657 GCTTTTGGGGCTGCAGGTGCAGG - Intronic
947535713 2:230939519-230939541 GCTCCCTGGGCTGCAAGAGCTGG + Intronic
947744419 2:232500187-232500209 CTTCCTGGGGCTGCAGGAGTGGG + Intergenic
947748877 2:232522788-232522810 GCTCCTGGGGCTCCTGGGGCAGG - Exonic
948585347 2:239015634-239015656 GCTCATGGCCCTGCAGGAGCTGG + Intergenic
948907605 2:240987146-240987168 GCTGCTGGGGGTGGAGGAGCAGG + Intronic
1170759499 20:19237251-19237273 GCTCCTGGGCCTGCAGGCGGGGG + Intronic
1170964075 20:21050923-21050945 CCTCATGGGGCTGCACTACCTGG - Intergenic
1172178819 20:32988321-32988343 GATCCTGGGGGTGCCCGAGTTGG + Intronic
1172231901 20:33342331-33342353 GTTCCGGGAGCTGCACGAGCTGG - Intergenic
1172871128 20:38136161-38136183 ACTCCTGGAGCTGCACGCCCTGG - Intronic
1173798350 20:45878442-45878464 GCCCCTCGGTCTGCATGAGCAGG - Exonic
1173822989 20:46030665-46030687 GCGCCTAGGGCTGAAAGAGCAGG + Intronic
1174021670 20:47535311-47535333 GCCACTGGGGCTTCAGGAGCTGG - Intronic
1174064492 20:47854727-47854749 GCTTCTGGGGCTGCAAAGGCTGG + Intergenic
1175234644 20:57501655-57501677 GCTCCTGGGGCTTCTCCATCCGG - Intronic
1175305061 20:57970285-57970307 GCTCATGGTACTGCACTAGCTGG - Intergenic
1175441212 20:58993463-58993485 GGACCTGGGGGTGCAGGAGCTGG - Exonic
1175503567 20:59466899-59466921 GCGGCTGGGGCTGCAGGGGCAGG + Intergenic
1175678155 20:60965038-60965060 GCTGCTGGGGCTGCTAAAGCGGG - Intergenic
1175931090 20:62494057-62494079 GCCCCAGCGGCTGCAGGAGCAGG - Intergenic
1176062366 20:63178085-63178107 GCTCCTGGGTCGGCACGGGCAGG + Intergenic
1176279052 20:64290424-64290446 GCTCCTGGGTCAGCATGGGCAGG - Intergenic
1176283292 20:64327594-64327616 GCTCCTGGAGCAGCCCCAGCGGG - Intergenic
1176285371 21:5016475-5016497 GTTCCTGGGGCTGCCTGTGCCGG - Intergenic
1178794344 21:35730103-35730125 GCTCCAGGAGCAGCACGAGGAGG - Intronic
1178803466 21:35818652-35818674 GCCCCTGGCGCTGCACAGGCTGG - Intronic
1179558379 21:42195055-42195077 GCTCCTGTGGCTTCTCCAGCCGG - Intergenic
1179871810 21:44247000-44247022 GTTCCTGGGGCTGCCTGTGCCGG + Intronic
1180090971 21:45533698-45533720 TCACCTGGGGCAGCACGAGTGGG - Intronic
1180246449 21:46551074-46551096 CATCCTGGAGCTGGACGAGCTGG + Intronic
1180614707 22:17119960-17119982 GCCGCTGGGGCTGCAGCAGCAGG + Exonic
1180791743 22:18578489-18578511 GCTCCTGGGGAAGCCCGGGCTGG + Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180967502 22:19798251-19798273 GCTCCTGGGTCTGCAAGCACAGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181229993 22:21416820-21416842 GCTCCTGGGGAAGCCCGGGCTGG - Intergenic
1181248656 22:21518046-21518068 GCTCCTGGGGAAGCCCGGGCTGG + Intergenic
1181635603 22:24172976-24172998 TCTCCTGGGGCCCCACCAGCTGG - Intronic
1181777847 22:25172332-25172354 GCTCCTGGGGTGGCCCGAGGAGG - Intronic
1182122723 22:27797872-27797894 GCTCCTGGGGCCCCAGGACCCGG - Exonic
1183978203 22:41525273-41525295 GCTCCAGGAGCTGCAGGCGCTGG - Exonic
1184040318 22:41939260-41939282 GCTGCAGGGGCTGCCAGAGCAGG + Intronic
1184263809 22:43335575-43335597 TCTGGTGGGGCTGCATGAGCTGG - Intronic
1184352323 22:43952346-43952368 GCTGGTGGGACTGCAGGAGCTGG - Intronic
1184523899 22:45010168-45010190 GCTCCGGGGACTGCTCGGGCCGG + Intergenic
1184928461 22:47661254-47661276 GCGGCTGGGGCTGCACAAGAGGG - Intergenic
1185227533 22:49661395-49661417 GCTGTGGGGGCTGCAGGAGCTGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950163038 3:10774256-10774278 GCTCCTGGGGCTGAACCATGTGG + Intergenic
950589603 3:13927192-13927214 GCTTCTGGGGCTGCAGGTGATGG - Intergenic
950726178 3:14918499-14918521 GCACCTGGGGTTGCCCGGGCTGG + Intronic
950894273 3:16433957-16433979 GCTCCTGGAGCTGTACCAGCAGG - Exonic
954701465 3:52453003-52453025 GCTTCTGAGGCGGCACTAGCAGG - Intronic
958034155 3:88150157-88150179 GGTCCTGAGGCTGCACCAGGCGG - Exonic
959542122 3:107552052-107552074 GCTCCTGGGGCTGGGCGCACTGG + Intronic
960704079 3:120465104-120465126 CCTTCTGGGGCTGCATGAGAAGG - Intergenic
961445986 3:126982093-126982115 GCTCCTGGGGAGGGAGGAGCGGG + Intergenic
962620209 3:137170489-137170511 TCTCCTGCGGCTGCATGACCTGG + Intergenic
964477447 3:157109774-157109796 GCTCCTGGAGCTGCAAGCCCAGG + Intergenic
966162600 3:176983971-176983993 GATCCTAGGGCTTCACAAGCTGG - Intergenic
966431467 3:179835071-179835093 GTTCCTGGGGCTACAGAAGCTGG + Intronic
968371224 3:198223734-198223756 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
968501633 4:952919-952941 GCTCCTGGGGCCGCATGTGGGGG - Intronic
968833349 4:2944948-2944970 ACATCTGGGGCTGCTCGAGCCGG + Intronic
969216021 4:5723122-5723144 GCACCTGGGGATGGAGGAGCCGG - Intronic
969268245 4:6080204-6080226 GTTCCTGAGGCTGCAGGTGCTGG - Exonic
969271407 4:6105805-6105827 GCTCATCCGGCAGCACGAGCAGG - Exonic
969411593 4:7031951-7031973 GCTCCTCGAGGTGCAGGAGCAGG + Exonic
969625006 4:8297890-8297912 GCAGGTGGGGCTGCAGGAGCAGG - Intronic
970445975 4:16123656-16123678 GCTCCTCGGGTTGAAAGAGCTGG - Intergenic
971310382 4:25521092-25521114 GCTCCTGGGGATGCGCGCGGTGG + Intergenic
973646698 4:52957246-52957268 GCACCTGGGTCTGCAAGTGCTGG + Intronic
975473219 4:74794063-74794085 GCACCTGGGGCTGCACCTGCTGG - Intronic
977507536 4:97921262-97921284 GATCCTGGGGCTGCCGGAGCAGG - Intronic
979328474 4:119404418-119404440 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
979378786 4:119983451-119983473 GTTCCTGGAGCTCCAGGAGCAGG - Intergenic
980866719 4:138561441-138561463 GCAGATGGGGCTGCACGTGCTGG + Intergenic
983667802 4:170201924-170201946 GTTCCTGGGACTGCAGGGGCTGG - Intergenic
985480397 5:107043-107065 GCTTCAGGGGCTGCCCCAGCAGG + Intergenic
985577605 5:680904-680926 GCTGCTGGGTCTGGAGGAGCAGG + Intronic
985592535 5:773002-773024 GCTGCTGGGTCTGGAGGAGCAGG + Intergenic
985967513 5:3348916-3348938 GCTCTTGGGCCTTCACGAGCTGG - Intergenic
986429610 5:7668382-7668404 GCTCATGTGACTGCAGGAGCTGG - Intronic
987219234 5:15772544-15772566 GCTTCTGTGGCTGCACCAGGGGG - Intronic
989617154 5:43348541-43348563 GCACCTGGTGCTGCACCAGTGGG + Intergenic
992751907 5:79870044-79870066 TTTCCTGGGGCAGCATGAGCAGG + Intergenic
997303481 5:132823086-132823108 CCTCCTGCCGCTGCAGGAGCCGG + Exonic
999268030 5:150279700-150279722 GCCCCTGAGGGTGGACGAGCAGG + Intronic
999462039 5:151766008-151766030 GCAGCTGGTGCTGCACCAGCAGG - Intronic
1002255204 5:177953372-177953394 GCTCCGGGGGCTGCAGGAGGTGG - Intergenic
1002482932 5:179515362-179515384 GCTCCGGGGGCTGCAGGAGGTGG + Intergenic
1003049397 6:2766008-2766030 CCTCCCGGGGCTGCTGGAGCGGG - Exonic
1003172487 6:3730845-3730867 GCTCCTCAGGAGGCACGAGCAGG + Intronic
1003366166 6:5476822-5476844 ACTCCTGAGGCTGCACCAGGGGG + Intronic
1006803231 6:36772391-36772413 GCTCCTGGGGCTTCTAGAGTGGG - Intronic
1007412146 6:41671133-41671155 GCTCCTGGAGCTGAGCGACCAGG + Intergenic
1008009094 6:46444726-46444748 GCCCCTGGGTCTGCTGGAGCAGG - Intronic
1013366950 6:109443863-109443885 ACTCCTGGGGCAGCAGGAGGGGG + Exonic
1016383723 6:143511619-143511641 GCTCCTGGGGCCGCATGTCCCGG + Exonic
1017017965 6:150116691-150116713 CCTCATGGGGCTGCCCGGGCAGG + Intergenic
1017545837 6:155450146-155450168 TCTCCTGGGGCTCCCCCAGCAGG - Intronic
1017864559 6:158431767-158431789 ACTCCTGGGGCTGGAGGAGTCGG + Intronic
1017961878 6:159230509-159230531 GATTCAGGGGCTGCACGTGCAGG - Intronic
1019294670 7:267389-267411 GGTCCTGGGGAGGCAGGAGCAGG - Intergenic
1019430111 7:995162-995184 GCCCCTGGGGTTGCATGGGCGGG + Intergenic
1019538656 7:1541635-1541657 GCTCCTGGGGGTGTGCGCGCAGG - Exonic
1019722017 7:2578360-2578382 GCTCCTGGCGCTTCACGGACGGG + Intronic
1020914486 7:14175432-14175454 GTTCCTGGGGGTGCAGGAGGTGG - Intronic
1021501391 7:21335792-21335814 CCCACTGGGGCTGCAGGAGCAGG + Intergenic
1021610644 7:22454673-22454695 GCTGCAGGTGCTGCAGGAGCTGG + Intronic
1022094495 7:27130370-27130392 GCGCCGGGGGCTGCTCGGGCTGG + Exonic
1022355081 7:29607007-29607029 GCTCCTGGGGCTGCCGCTGCTGG + Intergenic
1022360101 7:29649442-29649464 GCACCAGGGGCTGCAGGCGCTGG + Intergenic
1023520468 7:41045674-41045696 GCTTCTGAGGCTGGAGGAGCAGG - Intergenic
1023638618 7:42237247-42237269 GATGCCGGAGCTGCACGAGCGGG - Intronic
1023969636 7:44981350-44981372 GCTCCTACGGCTGCACCTGCAGG + Intergenic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1024318483 7:48043124-48043146 TCTCCAGGGGCTGCACATGCTGG - Intronic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1024647990 7:51384844-51384866 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025051844 7:55739343-55739365 GCTGCTGGGGAAGCATGAGCAGG + Intergenic
1025128802 7:56365011-56365033 GCTGTTGGGGCAGCATGAGCAGG + Intergenic
1025177183 7:56807889-56807911 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1025694609 7:63768497-63768519 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1026745253 7:73006277-73006299 GCTCCGGGGCCTCCACGAGGCGG - Intergenic
1027056333 7:75052451-75052473 GCTTCTTGGGGTGCAGGAGCTGG - Intronic
1027098489 7:75358819-75358841 GCTCCGGGGCCTCCACGAGGCGG + Intergenic
1027183231 7:75953877-75953899 GCCCCTGGGGCTGCAGGAAATGG - Intronic
1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG + Intronic
1029371851 7:100155357-100155379 GCTGCTGGGGCTGCTCTTGCGGG + Exonic
1029399598 7:100335712-100335734 GCTCCGGGGCCTCCACGAGGCGG + Intergenic
1032052134 7:128656200-128656222 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1032315001 7:130829396-130829418 GATCCTGGGTCTGCAAGGGCAGG + Intergenic
1034462295 7:151204640-151204662 GCTTCTGCGGCTGCACCATCTGG + Exonic
1034501415 7:151453209-151453231 GCTCCAGGGGCTGCGGCAGCTGG + Intergenic
1034781637 7:153887215-153887237 GCTCCGGGGGCTCCTCCAGCAGG - Intronic
1034931600 7:155167859-155167881 CCACCTGGGGCTGCATCAGCAGG - Intergenic
1035585672 8:771453-771475 AATCCTGGGCCTGCACTAGCCGG + Intergenic
1035609152 8:948733-948755 GCCCCTGGGGCTGAGTGAGCAGG + Intergenic
1035901801 8:3465133-3465155 GCTGCTGGGGCCTCACCAGCAGG + Intronic
1036806042 8:11834488-11834510 GCACCTGGGGCTCAAAGAGCCGG - Intronic
1037949057 8:23007049-23007071 CATCCTGGTGCTGCAGGAGCGGG + Exonic
1038992086 8:32878904-32878926 GCTCCTGGGTCTGAAAGAGGAGG - Intergenic
1039474653 8:37833325-37833347 GCTCCTGGCTCTGCACAGGCAGG - Intronic
1041560222 8:59209123-59209145 GATCCAGGGGCTGCACATGCAGG + Intergenic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1045878872 8:107014785-107014807 CATCCTGGGGCTGCAGGGGCAGG - Intergenic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1049232880 8:141493315-141493337 CCTCCTGGGGCTTCATGAGGAGG - Intergenic
1050143080 9:2537142-2537164 GGTGCTGGGGCTGCACAAGATGG + Intergenic
1056787548 9:89603953-89603975 GCTCCAGGGGCTGCAGCCGCGGG + Intergenic
1057138951 9:92715318-92715340 GCGGCTGGAGCTGCTCGAGCTGG - Exonic
1057214579 9:93220792-93220814 GATGCTGGGGCAGCACGGGCAGG - Intronic
1060219028 9:121754747-121754769 GCTCCTGGGGTTGCAGGACCAGG + Intronic
1060970576 9:127735210-127735232 GCTCCTCGGGCTGCTCGGGCTGG - Exonic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061799612 9:133106745-133106767 ACTCCTGGGGCGGGAAGAGCAGG + Exonic
1061895113 9:133643115-133643137 CCCACTGGGGCTGCAGGAGCTGG + Intronic
1062096904 9:134708225-134708247 GTGCCTGGGGCTGCCCGAGGCGG - Intronic
1062141790 9:134963218-134963240 GCTCCTGGGGCCTCGCGTGCTGG - Intergenic
1062192045 9:135253129-135253151 GCTCCTGGAGCTGGAGGAGCAGG + Intergenic
1062459569 9:136657242-136657264 TCTCCAGGGCCTGCAGGAGCGGG + Intergenic
1062645038 9:137543526-137543548 GCTCCTTGGGCTGCAGGGCCGGG + Exonic
1062754873 9:138281790-138281812 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1203578781 Un_KI270745v1:25959-25981 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1188770412 X:34147375-34147397 CCTCCTGGAGCTGCACTACCTGG + Intergenic
1189010654 X:37043211-37043233 CCTCCTGGAGCTGCACCAGCTGG - Intergenic
1189014141 X:37078038-37078060 CCTCCTGGAGCTGCACCAGCTGG - Intergenic
1189030150 X:37441864-37441886 CCTCCTGGAGCTACACCAGCTGG + Intronic
1189035749 X:37492344-37492366 CCTCCTGGAGCTGCACCAGCTGG + Intronic
1189037234 X:37505657-37505679 CCTCCTGGAGCTGCACCAGCTGG + Intronic
1192382783 X:70635769-70635791 GATCCTGGGGCTGCAGGGGCTGG - Intronic
1192771354 X:74195409-74195431 GACCCTGAGGCTGCAGGAGCAGG + Intergenic
1192788137 X:74354401-74354423 GAGCCTGGGGCTGCAGGAGCTGG - Intergenic
1193088149 X:77465888-77465910 GATCCTGGGGGTGCATGTGCAGG + Intergenic
1195708621 X:107756833-107756855 GCCCCAGGGGCTGCATCAGCTGG + Intronic
1199267610 X:145846679-145846701 GCACCTGTGGCTGCAATAGCAGG + Intergenic
1200060532 X:153481841-153481863 GTTCCTGGGGCTGCCCAACCTGG + Intronic
1202381403 Y:24278577-24278599 GCTGCTGGGGCAGCAAGGGCAGG - Intergenic
1202489382 Y:25391549-25391571 GCTGCTGGGGCAGCAAGGGCAGG + Intergenic