ID: 927981947

View in Genome Browser
Species Human (GRCh38)
Location 2:27380053-27380075
Sequence GGTTAAGGATTAGCGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927981947_927981957 26 Left 927981947 2:27380053-27380075 CCAGCGGCCGCTAATCCTTAACC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927981947 Original CRISPR GGTTAAGGATTAGCGGCCGC TGG (reversed) Intronic
901059642 1:6466089-6466111 GGCTATGGAGCAGCGGCCGCGGG - Exonic
903712815 1:25338480-25338502 GGTAAGAGAGTAGCGGCCGCAGG + Intronic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
1072716336 10:97755267-97755289 GGTTCAGGAGCAGAGGCCGCAGG - Intronic
1118312477 14:64704214-64704236 GGTTAACGATTAACGCCCGCAGG - Intronic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1137665301 16:50246103-50246125 GGGGAAGGAGGAGCGGCCGCAGG - Intergenic
1141430389 16:83968132-83968154 AGTTAAGGATGGGCGCCCGCGGG + Intergenic
1144769680 17:17752615-17752637 GGATGAGGATTAGGGGGCGCTGG - Intronic
1155494022 18:26425308-26425330 GGTTAGGGATGAGCGGTTGCAGG + Intergenic
926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG + Intronic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
928481891 2:31691887-31691909 GTATAAGGATTAGGGGCCACTGG + Intergenic
937765915 2:125660285-125660307 GGTTAAGGATTAGTGCACACTGG + Intergenic
1172525099 20:35595974-35595996 GGTTAAGTATTAGCGAGCTCTGG - Intergenic
1185300438 22:50077203-50077225 GGTGAGGGGTTGGCGGCCGCTGG - Intronic
956256793 3:67291823-67291845 GGTTTTAGATTAGCGGCTGCAGG - Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1058905258 9:109477650-109477672 GGTTAATTATTAGCAGCAGCGGG + Intronic
1062679845 9:137773264-137773286 GGTTCAGGACCAGCGGCTGCAGG - Intronic
1192185774 X:68946005-68946027 GGTTGAGGAATGGCGGCAGCCGG - Intergenic