ID: 927981947

View in Genome Browser
Species Human (GRCh38)
Location 2:27380053-27380075
Sequence GGTTAAGGATTAGCGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927981947_927981957 26 Left 927981947 2:27380053-27380075 CCAGCGGCCGCTAATCCTTAACC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927981947 Original CRISPR GGTTAAGGATTAGCGGCCGC TGG (reversed) Intronic