ID: 927981951

View in Genome Browser
Species Human (GRCh38)
Location 2:27380080-27380102
Sequence GACTCGGAAGGTGGGTTTTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927981951_927981957 -1 Left 927981951 2:27380080-27380102 CCCGAAAACCCACCTTCCGAGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927981951 Original CRISPR GACTCGGAAGGTGGGTTTTC GGG (reversed) Exonic
901385018 1:8902385-8902407 GACTCAGAAGGTGGGTTTGTGGG - Intergenic
901892157 1:12275914-12275936 GACTCGGGAGGTGGGGTGTTAGG - Exonic
904870377 1:33613970-33613992 GACTGGGAAGGTTGTTTTTTTGG - Intronic
905326787 1:37158620-37158642 GAGTTGGAAGGTGGGTTTGAGGG + Intergenic
919432181 1:197509163-197509185 GACTGGGATTGTGGGTTTTGAGG - Intronic
922531787 1:226350424-226350446 GACTGGGACGTTGGGTTTTGTGG - Intergenic
923301886 1:232648960-232648982 TACTAGGAGGGTGGGTTCTCTGG + Intergenic
1064651512 10:17514588-17514610 GACAGGGCAGGTGTGTTTTCTGG + Intergenic
1065062267 10:21915287-21915309 GATTGGGAAAGTGGGATTTCTGG - Intronic
1066391330 10:34979500-34979522 GGCTCAGAATTTGGGTTTTCTGG - Intergenic
1069434886 10:68372030-68372052 TACTCAGAAGGTGGGATTACAGG - Intronic
1071574509 10:86715820-86715842 GACCTGGTAGCTGGGTTTTCAGG - Intronic
1072895146 10:99360099-99360121 ATCTCTAAAGGTGGGTTTTCTGG - Intronic
1075537887 10:123286353-123286375 GACTCGGAAGGCTGTTCTTCCGG + Intergenic
1080870751 11:36234911-36234933 GACTGTGAACCTGGGTTTTCTGG - Intergenic
1081774275 11:45666593-45666615 GACTAGGAAGGTGCTTTGTCTGG + Intergenic
1090306108 11:125692708-125692730 GCCTGGGAAAGAGGGTTTTCTGG + Intergenic
1091613991 12:2035203-2035225 GACTTGGAAGGTGGCAGTTCTGG - Intronic
1091911452 12:4233690-4233712 CACTGGGTAGGTGGGTTTCCAGG - Intergenic
1092289171 12:7148902-7148924 GAAACAGAATGTGGGTTTTCGGG + Intronic
1095262745 12:40116335-40116357 GACTCCCAAGGTGGGTTTATAGG - Intergenic
1101631150 12:106496245-106496267 GACTCTGAAGCTGTTTTTTCAGG + Intronic
1102509617 12:113405337-113405359 AACAAGGAAGGTGAGTTTTCTGG + Intronic
1103929478 12:124441855-124441877 GACTGGGATGGTGGGTTTTGGGG - Intronic
1106475272 13:30093078-30093100 GACTGGGAGGGTGGGGTTTGAGG - Intergenic
1107738989 13:43428841-43428863 GAGTTAGAAGTTGGGTTTTCTGG - Intronic
1112174006 13:97003644-97003666 GGCCTGGAAGGTTGGTTTTCAGG - Intergenic
1117512860 14:56471092-56471114 GGCTGGGAAGGTGTGTTCTCAGG + Intergenic
1120915777 14:89708848-89708870 GACTCTGAAACTGGGTTGTCCGG - Intergenic
1125475617 15:40046372-40046394 GACTCTAATGGTGGGATTTCTGG + Intergenic
1126535052 15:49752185-49752207 CACTCTGAAGCTGGGTTTTTTGG - Intergenic
1128781257 15:70360102-70360124 GACTCTGGAGATGGGATTTCAGG + Intergenic
1129755826 15:78098444-78098466 GCCGTGGCAGGTGGGTTTTCTGG - Exonic
1136512518 16:30748126-30748148 GACCCGGAAGTTGGGTTTACTGG - Intergenic
1140126637 16:72123696-72123718 GACTCGGAAGGAGGGCTGACAGG - Intronic
1144338749 17:14296262-14296284 GACTGGGAAAGCGGGTCTTCTGG + Intergenic
1145061566 17:19737457-19737479 GAGTCTGAAGCTGGGTGTTCTGG - Intergenic
1149650237 17:58271993-58272015 TGTTGGGAAGGTGGGTTTTCTGG - Intronic
1152913621 17:83020365-83020387 GACTCGGCTCCTGGGTTTTCTGG - Intronic
1155247962 18:23928278-23928300 GATACGGAAGGTGGGTTGGCTGG - Intronic
1157286690 18:46381857-46381879 AACTCCAAAGGTGGGGTTTCAGG + Intronic
1160538267 18:79606925-79606947 GACTCTGAGGGCGGGTTGTCGGG - Intergenic
1163100381 19:15092295-15092317 GACAGGGAAGCTGGGTTTGCAGG + Intergenic
1165195866 19:34102824-34102846 GACTGGGATTGTGGGTTTTTGGG - Intergenic
925803349 2:7624594-7624616 GACTGGGAAGGTGGGGGTTGAGG - Intergenic
927981951 2:27380080-27380102 GACTCGGAAGGTGGGTTTTCGGG - Exonic
929773880 2:44915757-44915779 TCCTAGGAAGGTGGGTCTTCAGG + Intergenic
930290910 2:49491404-49491426 GGATGGGAAGGTGGGTTCTCTGG - Intergenic
935376145 2:102399723-102399745 GACTCGCCAGTTGGGTTTGCTGG + Intergenic
936634366 2:114238455-114238477 GACTCAGAATCTGGATTTTCTGG + Intergenic
939490421 2:142869444-142869466 GAATCAGCAGGTCGGTTTTCAGG + Intergenic
939767360 2:146267388-146267410 GATGAGGAAGGTGGGTTTTGGGG + Intergenic
940787398 2:157996640-157996662 TACTCAAAAGGTTGGTTTTCAGG - Intronic
941326001 2:164115059-164115081 GGCTCAGAAGGTGGTTCTTCTGG + Intergenic
943183838 2:184579004-184579026 GACTTGGAATATGGGTTTTGGGG - Intergenic
1172951583 20:38726242-38726264 GCCACGGAAGGCAGGTTTTCTGG + Intronic
1181331573 22:22096544-22096566 GACGCACAAGGTGGGTCTTCAGG - Intergenic
1182001503 22:26923611-26923633 GACCCAGAATGTGGGTTTCCTGG + Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
953837342 3:46358202-46358224 GACACCGAAGCAGGGTTTTCAGG - Exonic
955013065 3:55038720-55038742 GCCTCTCAAGGTGGGTTTTATGG - Intronic
955131323 3:56171919-56171941 GACTGGGAAGGTGGGTGTGGAGG + Intronic
957615752 3:82524525-82524547 GACTGTGTAGCTGGGTTTTCTGG - Intergenic
960609057 3:119538393-119538415 AAGTTGGATGGTGGGTTTTCAGG - Intronic
960823927 3:121762514-121762536 GACTGAGAAGGTTGGTTATCTGG - Intergenic
961560210 3:127723531-127723553 GACTGGGAAGGTGGGTGTGGGGG - Intronic
964606739 3:158568473-158568495 CACTCAGAAGGTGAGTTTTAAGG + Intergenic
967729023 3:192889860-192889882 GACTCTGGATGTGGGTGTTCAGG - Intronic
973872044 4:55176370-55176392 GAGTGGCAAGGTGGGTTATCAGG + Intergenic
981305016 4:143238026-143238048 AACTCAGAAGGTGGGATTACAGG - Intergenic
983917126 4:173304109-173304131 AACTCTGAAGGTGAGTTTTTTGG + Exonic
985392105 4:189500623-189500645 CACTCTGAACGTGGGTTTTTAGG - Intergenic
988953147 5:36285721-36285743 GCCTCTGAATGTGGGTTTCCTGG - Intronic
997265503 5:132492440-132492462 GAATGGAAAGGTGGGTTTTGGGG + Intergenic
1001134437 5:169090660-169090682 GAGACTGAAGCTGGGTTTTCTGG + Intronic
1005396090 6:25383240-25383262 GGCTCGGATGGTGGTTTTTGAGG + Intronic
1005740859 6:28789259-28789281 GCCTCGGCAGGTGGGTTTACAGG - Intergenic
1005891741 6:30146080-30146102 GGCTCTGCAGGTGGGTTTTTCGG + Exonic
1006149883 6:31981345-31981367 AAATAGGAAGGTGGGATTTCTGG + Exonic
1006156184 6:32014083-32014105 AAATAGGAAGGTGGGATTTCTGG + Intergenic
1014034340 6:116747616-116747638 AACTAGGAAGGTGGGTAGTCTGG + Intergenic
1016385433 6:143526225-143526247 GACATGGAAGGAGGGATTTCTGG + Intergenic
1018275187 6:162122830-162122852 GATTCTGCAGGTGTGTTTTCTGG - Intronic
1022599702 7:31746140-31746162 GTCACTGGAGGTGGGTTTTCTGG + Intergenic
1023673959 7:42610840-42610862 TACTTGGATGCTGGGTTTTCAGG + Intergenic
1024303461 7:47905620-47905642 GAATGGGAAGGTGGGTTATCGGG - Intronic
1027642767 7:80757636-80757658 TCCTAGGAAGGTGGGTTTTAAGG + Intronic
1032511131 7:132473238-132473260 GGCTCTGAAGTTGGTTTTTCTGG + Intronic
1037610680 8:20473638-20473660 GACTGGGAAGGAGGGTCTTTGGG + Intergenic
1038528307 8:28296028-28296050 GACTTCCAAGGTGGGTTTTGAGG - Intergenic
1039419859 8:37427811-37427833 AACTTGAAATGTGGGTTTTCTGG - Intergenic
1040559986 8:48515085-48515107 GGCTCGGGAGGAGGGTTTTGGGG + Intergenic
1044403976 8:91805813-91805835 AACTCTGAAGCTGGGATTTCTGG - Intergenic
1045993859 8:108340527-108340549 GGTTCGGAGGGTGGGTTTTTGGG - Intronic
1047111953 8:121800488-121800510 GACTAGGGTGGTGGGCTTTCAGG - Intergenic
1047619180 8:126588880-126588902 GACTGGGGAGGTGGGTTGTGTGG - Intergenic
1052058256 9:23926895-23926917 GACCTGGAAGGTGGCTTTGCTGG + Intergenic
1056693979 9:88830780-88830802 GTCTCAGAAAGTGGGTTTTCAGG + Intergenic
1061054287 9:128214138-128214160 GAGTTGGACGGTGGGTTTCCTGG - Intronic
1189630063 X:42943275-42943297 GACTCTGAATTTTGGTTTTCAGG + Intergenic
1190961862 X:55258677-55258699 GACTTTGAAGGTAGGCTTTCAGG + Intronic
1195417916 X:104641014-104641036 GACTGGGTAGGTGGGTTCTTAGG + Intronic