ID: 927981957

View in Genome Browser
Species Human (GRCh38)
Location 2:27380102-27380124
Sequence CTCTCTCGAAGCCCATGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927981950_927981957 5 Left 927981950 2:27380074-27380096 CCAAGACCCGAAAACCCACCTTC 0: 1
1: 0
2: 1
3: 5
4: 128
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
927981953_927981957 -9 Left 927981953 2:27380088-27380110 CCCACCTTCCGAGTCTCTCTCGA 0: 1
1: 0
2: 1
3: 3
4: 76
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
927981952_927981957 -2 Left 927981952 2:27380081-27380103 CCGAAAACCCACCTTCCGAGTCT 0: 1
1: 0
2: 2
3: 10
4: 393
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
927981954_927981957 -10 Left 927981954 2:27380089-27380111 CCACCTTCCGAGTCTCTCTCGAA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
927981947_927981957 26 Left 927981947 2:27380053-27380075 CCAGCGGCCGCTAATCCTTAACC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
927981948_927981957 19 Left 927981948 2:27380060-27380082 CCGCTAATCCTTAACCAAGACCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
927981951_927981957 -1 Left 927981951 2:27380080-27380102 CCCGAAAACCCACCTTCCGAGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
927981949_927981957 11 Left 927981949 2:27380068-27380090 CCTTAACCAAGACCCGAAAACCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927981957 Original CRISPR CTCTCTCGAAGCCCATGAGC TGG Exonic
902513383 1:16977930-16977952 CTCTCTGGGAGCCGATGTGCAGG - Intronic
907360531 1:53910306-53910328 CTCTCTCAAAGACCGTGTGCAGG - Exonic
909349860 1:74638734-74638756 TTCTCTCTAAGCACATGACCTGG - Intronic
911225943 1:95305705-95305727 ATCTCTGGCAGTCCATGAGCAGG + Intergenic
914898098 1:151695071-151695093 CTCTATGGCAACCCATGAGCCGG - Exonic
918198448 1:182244543-182244565 CTCTCTGGAAGGACATGAGGTGG - Intergenic
919819842 1:201465971-201465993 GTGGCTCGAAGCCCCTGAGCTGG + Exonic
920417316 1:205807430-205807452 CCCACTCCAGGCCCATGAGCTGG - Intronic
924603622 1:245513313-245513335 CTCTCTCAAAGACCATGTGCAGG - Intronic
1067084561 10:43230918-43230940 CTGTCTCCAGGCCCTTGAGCTGG - Intronic
1072675152 10:97460214-97460236 CACTCAGGAGGCCCATGAGCTGG + Exonic
1073764084 10:106662885-106662907 CTCACAGGCAGCCCATGAGCAGG + Intronic
1076779071 10:132714040-132714062 CTCCCACGGAGCCCAGGAGCAGG + Intronic
1077177997 11:1199286-1199308 CTCTCTGGAAGCCCACGGGCTGG + Intronic
1095397845 12:41781016-41781038 AACTCTCGAAGCCCAAGAACTGG + Intergenic
1095745442 12:45653274-45653296 CTCCCTCAAAGCACATGAGAAGG + Intergenic
1097661593 12:62436289-62436311 CTGTCTAGAAACCCAAGAGCGGG + Intergenic
1100255724 12:92881050-92881072 CTCTCTCTAGGCACATGATCAGG + Intronic
1104866970 12:131961486-131961508 TCCTCTCGAAGCCCAGGGGCCGG - Exonic
1104885519 12:132104854-132104876 TCCTCTCGAAGCCCAGGGGCCGG - Exonic
1115137287 14:30126140-30126162 CTCTCTTAAAGCCCAGCAGCTGG - Intronic
1124616895 15:31248591-31248613 CTCTCTCTGAGCCTCTGAGCAGG + Intergenic
1128560829 15:68666732-68666754 GCCTCTCTAAGCCCATGTGCTGG + Intronic
1133760174 16:8792248-8792270 CATTGTCGAAGCCCATGACCAGG - Intronic
1136518658 16:30782740-30782762 CTTCCTGGAAGCCCACGAGCTGG - Exonic
1138546272 16:57721778-57721800 CTCTCTGGAGGCCCAGGAACTGG - Intronic
1138752108 16:59435280-59435302 ATTTTTCTAAGCCCATGAGCTGG - Intergenic
1139672326 16:68500212-68500234 CTCTCTGGGTGCCCTTGAGCTGG + Intergenic
1140659051 16:77169802-77169824 CTTTCTCTAAGCCTGTGAGCAGG - Intergenic
1141651647 16:85396129-85396151 CTCACTGGGACCCCATGAGCAGG + Intergenic
1148745520 17:49915946-49915968 CTCCCTCGAAGCCCCTCCGCTGG - Intergenic
1150062969 17:62084681-62084703 CTCTCTCGAAGCCTGAGAACAGG + Intergenic
1150250968 17:63704305-63704327 CTCTCCCGAAGCCCAGGCCCAGG + Intronic
1151558929 17:74860689-74860711 CGCTCTGGAAGCCCGGGAGCCGG + Intronic
1152927743 17:83095332-83095354 GTCTCTAGACGCCCAGGAGCTGG + Intergenic
1158630528 18:59110265-59110287 CTCTCTAGACCCCCATGATCGGG - Intergenic
1160724200 19:610460-610482 CTCTCCTGGAGCCCAGGAGCCGG + Intronic
1162226009 19:9223500-9223522 TTCTTTCAAAGCCCATGACCAGG + Intergenic
1162304976 19:9866844-9866866 CTCCCTTAAAGCCCATTAGCAGG - Intronic
1165073227 19:33267604-33267626 CTCTCCCGGAGCCCTAGAGCAGG - Intergenic
927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG + Exonic
932074239 2:68648030-68648052 TTCTCTCTTAGCCCATGAACAGG + Intronic
934078861 2:88451416-88451438 CTCTCTGGAACCCGATGAGGAGG + Intronic
934295806 2:91742149-91742171 CTGTCTAGAAGCCCAGGGGCTGG + Intergenic
934975315 2:98798096-98798118 CTCTCTGGAAGGCCAAGAGGGGG + Intronic
937157554 2:119731738-119731760 CTCTCTCTCAGACCATGAGTGGG - Intergenic
941168074 2:162104730-162104752 CTCTCTCGAATCCCTTGCTCTGG + Intergenic
945261012 2:207843525-207843547 CTGTCCCTAAGCCCCTGAGCTGG + Intronic
1172137443 20:32696687-32696709 CTATCACGAAGCTCATGGGCTGG + Intergenic
1172781953 20:37441975-37441997 CTCTCTCCAAGCCCTTTATCAGG + Intergenic
1175403394 20:58713016-58713038 CTCTCCCCAGCCCCATGAGCTGG + Intronic
1175546085 20:59778604-59778626 GTCTCGCGGAGCCCATGTGCTGG - Intronic
1179454636 21:41490742-41490764 CTCCCTCCTGGCCCATGAGCTGG - Intronic
1179523643 21:41961581-41961603 CTCCCTCGGGCCCCATGAGCTGG - Intergenic
1181724738 22:24804075-24804097 CTCTCCCCAAGCCAATGGGCAGG + Intergenic
1183709237 22:39492681-39492703 CTCTCTGGACTCCCAGGAGCAGG + Intergenic
1184155320 22:42662949-42662971 ACCTCTCTGAGCCCATGAGCGGG - Intergenic
1184796170 22:46734205-46734227 CTGTCCAGAAGCCCATCAGCAGG + Intronic
952879512 3:37974720-37974742 CTTCCTTGAAGCCCAGGAGCTGG - Intronic
961035305 3:123637881-123637903 CTCCCTGGGAGCCCAGGAGCAGG + Intronic
962597137 3:136957775-136957797 CTCCCTAAAAGCCAATGAGCAGG - Intronic
972741262 4:41888845-41888867 CTCTCTGGAAACTCATGACCTGG - Intergenic
984428316 4:179616044-179616066 GTCTCTTGTAGCCCATGTGCTGG + Intergenic
992269701 5:75052733-75052755 CTGTCCCGAAGCCCAGGGGCGGG + Intergenic
1004905672 6:20235072-20235094 CTCTCTGGAAGCTCAAAAGCAGG - Intergenic
1018789591 6:167136838-167136860 CTGTCTCGGAGCCCATCAGGTGG + Exonic
1020737319 7:11967302-11967324 CTCTCTCAAAGCCCAGGATGAGG - Intergenic
1023337114 7:39181731-39181753 CTCTCTCACAGCAGATGAGCTGG + Intronic
1024733081 7:52274163-52274185 TTCTCCCGGAGCCCAGGAGCTGG - Intergenic
1028600034 7:92591055-92591077 CCCTCACGGAGCCCATCAGCTGG + Intergenic
1030668161 7:112305093-112305115 TTCTCTAGAATCTCATGAGCTGG + Intronic
1033438056 7:141352077-141352099 CTCTCACAAAGGCCATGAGGAGG - Intronic
1037923799 8:22829045-22829067 CTTTCTCAAAGCCCATCAGTGGG + Intronic
1038964573 8:32557502-32557524 CTGTCTTGAAGCCCATGAGATGG + Intronic
1041183734 8:55275866-55275888 CTCACTAGAGGACCATGAGCCGG + Intronic
1046255792 8:111694655-111694677 CCCTCTGGAAGCTCCTGAGCGGG + Intergenic
1047766647 8:127995375-127995397 CTGTCTCTAATCCCAGGAGCCGG - Intergenic
1048972924 8:139655272-139655294 CTCACTCGGTGCCCAAGAGCAGG + Intronic
1056825150 9:89872118-89872140 CTCTCTCAATGTGCATGAGCTGG + Intergenic
1061624696 9:131834878-131834900 CTTTCTCCGAGGCCATGAGCTGG + Intergenic
1062423193 9:136493912-136493934 AGCTGTCGAAGCCTATGAGCAGG - Intergenic
1185449805 X:276078-276100 CTGTCTCTAAGCCCCTGACCGGG + Intergenic
1188595450 X:31894349-31894371 CACTCGCAAAGCCCATGGGCTGG - Intronic
1194245084 X:91500595-91500617 CTCCCTCAAGGCCCAGGAGCAGG + Intergenic
1199491486 X:148405106-148405128 CTCTCTATATGACCATGAGCAGG + Intergenic