ID: 927982140

View in Genome Browser
Species Human (GRCh38)
Location 2:27380750-27380772
Sequence GCGAGTACGGAGGTACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927982140_927982144 7 Left 927982140 2:27380750-27380772 CCAGCTGGTACCTCCGTACTCGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 927982144 2:27380780-27380802 TCCGCCGCCGCAGAGACGCACGG 0: 1
1: 0
2: 1
3: 2
4: 38
927982140_927982151 30 Left 927982140 2:27380750-27380772 CCAGCTGGTACCTCCGTACTCGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982140_927982150 24 Left 927982140 2:27380750-27380772 CCAGCTGGTACCTCCGTACTCGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982140_927982149 23 Left 927982140 2:27380750-27380772 CCAGCTGGTACCTCCGTACTCGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 927982149 2:27380796-27380818 CGCACGGGACGCGTAGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 33
927982140_927982146 8 Left 927982140 2:27380750-27380772 CCAGCTGGTACCTCCGTACTCGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 927982146 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 3
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927982140 Original CRISPR GCGAGTACGGAGGTACCAGC TGG (reversed) Intronic