ID: 927982141

View in Genome Browser
Species Human (GRCh38)
Location 2:27380760-27380782
Sequence GGAAGCGGAAGCGAGTACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 75}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927982141_927982146 -2 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982146 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 3
3: 5
4: 64
927982141_927982151 20 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982141_927982155 30 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982141_927982150 14 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982141_927982153 29 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982153 2:27380812-27380834 TCCGTGGGAAGCGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 145
927982141_927982144 -3 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982144 2:27380780-27380802 TCCGCCGCCGCAGAGACGCACGG 0: 1
1: 0
2: 1
3: 2
4: 38
927982141_927982149 13 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982149 2:27380796-27380818 CGCACGGGACGCGTAGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 33
927982141_927982152 26 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982152 2:27380809-27380831 TAGTCCGTGGGAAGCGGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927982141 Original CRISPR GGAAGCGGAAGCGAGTACGG AGG (reversed) Intronic