ID: 927982142

View in Genome Browser
Species Human (GRCh38)
Location 2:27380763-27380785
Sequence GGCGGAAGCGGAAGCGAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927982142_927982150 11 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982142_927982146 -5 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982146 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 3
3: 5
4: 64
927982142_927982153 26 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982153 2:27380812-27380834 TCCGTGGGAAGCGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 145
927982142_927982144 -6 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982144 2:27380780-27380802 TCCGCCGCCGCAGAGACGCACGG 0: 1
1: 0
2: 1
3: 2
4: 38
927982142_927982155 27 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982142_927982152 23 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982152 2:27380809-27380831 TAGTCCGTGGGAAGCGGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 30
927982142_927982149 10 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982149 2:27380796-27380818 CGCACGGGACGCGTAGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 33
927982142_927982151 17 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927982142 Original CRISPR GGCGGAAGCGGAAGCGAGTA CGG (reversed) Intronic