ID: 927982143

View in Genome Browser
Species Human (GRCh38)
Location 2:27380775-27380797
Sequence CGTCTCTGCGGCGGCGGAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927982143_927982155 15 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982143_927982151 5 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982143_927982150 -1 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982143_927982156 26 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982156 2:27380824-27380846 GGCCGCGGCGGGAGCCTCAATGG 0: 1
1: 0
2: 0
3: 9
4: 140
927982143_927982149 -2 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982149 2:27380796-27380818 CGCACGGGACGCGTAGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 33
927982143_927982152 11 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982152 2:27380809-27380831 TAGTCCGTGGGAAGCGGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 30
927982143_927982153 14 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982153 2:27380812-27380834 TCCGTGGGAAGCGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927982143 Original CRISPR CGTCTCTGCGGCGGCGGAAG CGG (reversed) Intronic