ID: 927982145

View in Genome Browser
Species Human (GRCh38)
Location 2:27380781-27380803
Sequence CCCGTGCGTCTCTGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 62}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927982145_927982151 -1 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982145_927982153 8 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982153 2:27380812-27380834 TCCGTGGGAAGCGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 145
927982145_927982156 20 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982156 2:27380824-27380846 GGCCGCGGCGGGAGCCTCAATGG 0: 1
1: 0
2: 0
3: 9
4: 140
927982145_927982155 9 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982145_927982152 5 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982152 2:27380809-27380831 TAGTCCGTGGGAAGCGGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 30
927982145_927982158 29 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982158 2:27380833-27380855 GGGAGCCTCAATGGCGTGACCGG 0: 1
1: 0
2: 0
3: 7
4: 133
927982145_927982149 -8 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982149 2:27380796-27380818 CGCACGGGACGCGTAGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 33
927982145_927982150 -7 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982145_927982159 30 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982159 2:27380834-27380856 GGAGCCTCAATGGCGTGACCGGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927982145 Original CRISPR CCCGTGCGTCTCTGCGGCGG CGG (reversed) Intronic
900135895 1:1116787-1116809 CCCGTGAGTCTCGGCGGCCCCGG + Intergenic
900287701 1:1909325-1909347 GCCGTGCGTCCTAGCGGCGGCGG - Intergenic
901086147 1:6613549-6613571 CCCATGAGGCTCCGCGGCGGCGG - Intronic
904237240 1:29123515-29123537 CCCGCGCGTCGCTGCCGCGAGGG + Intronic
917661572 1:177181884-177181906 CGCCTGCGCCTCTGCGGCCGGGG - Intronic
1074146816 10:110724187-110724209 CCCGTTTGTCTCTGTGGCAGTGG + Intronic
1077156038 11:1092149-1092171 CCAGTCCCTCACTGCGGCGGGGG + Intergenic
1083546397 11:63552128-63552150 CCTGTGCTTCCCTGGGGCGGTGG + Intergenic
1084028483 11:66467158-66467180 CCCGCGCGTCCCTGCGGTCGCGG + Intronic
1085022516 11:73218335-73218357 CACGTGGGTCTCTGCGGCTGCGG + Exonic
1088690274 11:112320808-112320830 CCTGTGCGTCCCTGCGGCTTGGG - Intergenic
1093970527 12:25371471-25371493 CCCTTGAGTCCCTGAGGCGGAGG + Intergenic
1096674518 12:53219391-53219413 CCCCTGCGTGGCTGCGGGGGCGG - Intronic
1101518550 12:105460199-105460221 CCCTTCTGTGTCTGCGGCGGGGG + Intergenic
1104744365 12:131201840-131201862 CCAGTGCATCTCTGCTGAGGGGG - Intergenic
1104790014 12:131475383-131475405 CCAGTGCATCTCTGCTGAGGGGG + Intergenic
1106517161 13:30465389-30465411 CCGGCGCGGCTCGGCGGCGGCGG - Intronic
1107603952 13:42040582-42040604 CCCGTGGGAGGCTGCGGCGGTGG + Intronic
1121457250 14:94046291-94046313 GCAGTGCCTCTCTGCGGGGGAGG + Exonic
1121850561 14:97218517-97218539 CCCTTGCAACTCTGAGGCGGAGG + Intergenic
1124848101 15:33311094-33311116 ACTGTGAGTCTCCGCGGCGGGGG + Exonic
1129387278 15:75202831-75202853 CACGTGCGTCTCGGCGCCGCCGG + Intronic
1133187416 16:4109962-4109984 CCTGTGCTTCTCTGTGGGGGCGG - Intronic
1139923276 16:70472680-70472702 CCCGTGCTGCTCTGGGGCAGGGG - Intronic
1156275709 18:35581453-35581475 CCCGTGCGGCTGCGCGGGGGAGG - Intronic
1157849026 18:51030419-51030441 CCCGGGCCGCCCTGCGGCGGGGG - Exonic
1160903123 19:1438972-1438994 TCCAAGCGCCTCTGCGGCGGTGG + Intronic
1161115251 19:2493128-2493150 CCCGTGCCTGTCTGAGGAGGTGG - Intergenic
1161267351 19:3370387-3370409 CCCTCCCCTCTCTGCGGCGGAGG + Intronic
1163472309 19:17504771-17504793 CCCGTGCCTCTCTGCTGCCTTGG + Exonic
1163755940 19:19106173-19106195 CCCGCACGTCTCTGCTGGGGCGG - Intronic
1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG + Exonic
1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG + Exonic
927965354 2:27264551-27264573 CCCGTGCCGCTCTGCAGCAGCGG - Intronic
927982145 2:27380781-27380803 CCCGTGCGTCTCTGCGGCGGCGG - Intronic
928606108 2:32946758-32946780 CCCGTGGGTCGCCGAGGCGGAGG - Intergenic
934955240 2:98611983-98612005 CCCGTGTGTGTGTGTGGCGGTGG - Intronic
937942159 2:127294263-127294285 CTCGTGCGACCCAGCGGCGGGGG + Intergenic
940883188 2:158967980-158968002 CCCGGGCGTCCCTGGGGCCGCGG - Intergenic
946326128 2:218985461-218985483 CCCGCGCGTCTCCCCGGCTGCGG - Exonic
947731215 2:232432681-232432703 CCAGTGCGTCTCTGTGGGGTGGG + Intergenic
948824776 2:240568870-240568892 GCAGGGCGTCTCGGCGGCGGCGG - Exonic
1172661934 20:36574123-36574145 CCTGTCCGGCTCGGCGGCGGGGG - Intronic
1175899119 20:62353114-62353136 CCTGTGAGTCTCTGCCGCCGTGG - Exonic
1175962179 20:62642703-62642725 CCCGAGCCTCTCCGCGGGGGAGG + Intronic
1176081363 20:63274913-63274935 CCCGTGAGTCACTGTGGTGGGGG + Intronic
1176097858 20:63352524-63352546 CCCGAGCGTCCCTCCAGCGGGGG + Intronic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
954176233 3:48847814-48847836 CCCGTCGGTCCCCGCGGCGGCGG - Exonic
967493716 3:190120732-190120754 CCCGCGCCTCTCTGAGGCGGAGG - Exonic
968434559 4:577617-577639 CCAGTTCGTTTCTGCTGCGGCGG + Intergenic
969422024 4:7103070-7103092 CAGGGGCGTCTCTGCAGCGGCGG + Intergenic
981713703 4:147732662-147732684 CCCCTGCGGCTCTGCGGCGGCGG + Intronic
1006770305 6:36547428-36547450 CCAGCCCGTCTCCGCGGCGGGGG - Exonic
1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG + Exonic
1013441748 6:110179075-110179097 CCCGTGCCTCTTTCCGGGGGAGG - Intronic
1014635957 6:123846820-123846842 CGCGTGCGTGTGTGTGGCGGTGG - Intronic
1019933099 7:4236555-4236577 ACAGTGCGTGTTTGCGGCGGGGG + Intronic
1029456229 7:100673896-100673918 GCGGTGGGACTCTGCGGCGGAGG - Exonic
1051936474 9:22447617-22447639 CACGGGCGGCCCTGCGGCGGGGG + Exonic
1052362163 9:27573223-27573245 CCCGGGCTTCCCGGCGGCGGCGG - Intronic
1056751894 9:89357903-89357925 CCCCTGCTTCTCTGTGGAGGTGG + Intronic
1061149130 9:128818985-128819007 CCCGAGCGTCTCCGCGGCGACGG + Exonic
1061825300 9:133254871-133254893 ACGGTGTGTCTCTGTGGCGGGGG + Intronic
1062084561 9:134642029-134642051 CCCGTTCTTCTTTGTGGCGGCGG - Exonic
1203770745 EBV:48836-48858 CAACTGCGGCTCTGCGGCGGTGG + Intergenic
1197753413 X:129980425-129980447 ACGGTGCGGCCCTGCGGCGGGGG + Intergenic