ID: 927982147

View in Genome Browser
Species Human (GRCh38)
Location 2:27380784-27380806
Sequence CGTCCCGTGCGTCTCTGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927982147_927982158 26 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982158 2:27380833-27380855 GGGAGCCTCAATGGCGTGACCGG 0: 1
1: 0
2: 0
3: 7
4: 133
927982147_927982155 6 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982147_927982152 2 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982152 2:27380809-27380831 TAGTCCGTGGGAAGCGGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 30
927982147_927982159 27 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982159 2:27380834-27380856 GGAGCCTCAATGGCGTGACCGGG 0: 1
1: 0
2: 0
3: 4
4: 57
927982147_927982150 -10 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982147_927982151 -4 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982147_927982153 5 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982153 2:27380812-27380834 TCCGTGGGAAGCGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 145
927982147_927982156 17 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982156 2:27380824-27380846 GGCCGCGGCGGGAGCCTCAATGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927982147 Original CRISPR CGTCCCGTGCGTCTCTGCGG CGG (reversed) Intronic