ID: 927982150

View in Genome Browser
Species Human (GRCh38)
Location 2:27380797-27380819
Sequence GCACGGGACGCGTAGTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 3}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927982140_927982150 24 Left 927982140 2:27380750-27380772 CCAGCTGGTACCTCCGTACTCGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982143_927982150 -1 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982147_927982150 -10 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982141_927982150 14 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982142_927982150 11 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3
927982145_927982150 -7 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982150 2:27380797-27380819 GCACGGGACGCGTAGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 3

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927982150 Original CRISPR GCACGGGACGCGTAGTCCGT GGG Intergenic