ID: 927982151

View in Genome Browser
Species Human (GRCh38)
Location 2:27380803-27380825
Sequence GACGCGTAGTCCGTGGGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927982148_927982151 -7 Left 927982148 2:27380787-27380809 CCGCAGAGACGCACGGGACGCGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982143_927982151 5 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982141_927982151 20 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982142_927982151 17 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982147_927982151 -4 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982145_927982151 -1 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
927982140_927982151 30 Left 927982140 2:27380750-27380772 CCAGCTGGTACCTCCGTACTCGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 927982151 2:27380803-27380825 GACGCGTAGTCCGTGGGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927982151 Original CRISPR GACGCGTAGTCCGTGGGAAG CGG Intergenic