ID: 927982155

View in Genome Browser
Species Human (GRCh38)
Location 2:27380813-27380835
Sequence CCGTGGGAAGCGGCCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 208}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927982143_927982155 15 Left 927982143 2:27380775-27380797 CCGCTTCCGCCGCCGCAGAGACG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982142_927982155 27 Left 927982142 2:27380763-27380785 CCGTACTCGCTTCCGCTTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982148_927982155 3 Left 927982148 2:27380787-27380809 CCGCAGAGACGCACGGGACGCGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982141_927982155 30 Left 927982141 2:27380760-27380782 CCTCCGTACTCGCTTCCGCTTCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982147_927982155 6 Left 927982147 2:27380784-27380806 CCGCCGCAGAGACGCACGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208
927982145_927982155 9 Left 927982145 2:27380781-27380803 CCGCCGCCGCAGAGACGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 927982155 2:27380813-27380835 CCGTGGGAAGCGGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927982155 Original CRISPR CCGTGGGAAGCGGCCGCGGC GGG Intergenic