ID: 927984835

View in Genome Browser
Species Human (GRCh38)
Location 2:27402107-27402129
Sequence CTGCTAGCATTGGGTCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927984831_927984835 27 Left 927984831 2:27402057-27402079 CCTGTATACACATTTTCAAATAC 0: 1
1: 0
2: 2
3: 30
4: 367
Right 927984835 2:27402107-27402129 CTGCTAGCATTGGGTCAAAAAGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927984835 Original CRISPR CTGCTAGCATTGGGTCAAAA AGG Intronic
906249172 1:44298062-44298084 CTTCAAGCATTAGGTCCAAAAGG + Intronic
911450689 1:98056562-98056584 CTGCTAGCTTTTGTTCACAAAGG + Intergenic
916996474 1:170307113-170307135 CTGCTAGCATGGGATCAGAGGGG - Intergenic
1063367022 10:5497003-5497025 ATGGTAGCATTGGGTGAAATCGG - Intergenic
1063794509 10:9496943-9496965 CTGTTGGGATTGGGTAAAAATGG + Intergenic
1067508518 10:46876453-46876475 CTGCCAGAATTGAGCCAAAAGGG + Intergenic
1067653730 10:48175396-48175418 CTGCCAGAATTGAGCCAAAAGGG - Intronic
1072738208 10:97893642-97893664 CTGCAACCATTGGGTGAAACTGG - Intronic
1078614185 11:12849564-12849586 ATGCAAGCATTAAGTCAAAATGG - Intronic
1078616523 11:12871021-12871043 TTGAGAGCAGTGGGTCAAAAGGG - Intronic
1079588105 11:22150331-22150353 CTGTTGGCATTGGCTCACAAGGG + Intergenic
1083506988 11:63167184-63167206 CTGGTAGCATTGGCACACAAGGG - Intronic
1086470104 11:87099400-87099422 ATGCTACCATTGGGGGAAAATGG - Intronic
1087292798 11:96338941-96338963 CTGATAACATTGTGTCCAAAGGG - Intronic
1089151692 11:116369294-116369316 CTCCTAGCAATGGATCATAAAGG + Intergenic
1092205130 12:6610136-6610158 CTTCTAGGATTGGGTCCATAGGG - Intergenic
1099474881 12:83096024-83096046 CTGTTTGCATTGGTTCAAAAGGG - Intronic
1101549673 12:105750332-105750354 CTGCTATCATTGGGACACACAGG + Intergenic
1102558906 12:113748321-113748343 CTGCTAGCAGTGGGTTTGAAAGG - Intergenic
1109064551 13:57669817-57669839 CTCATAGCAATGAGTCAAAATGG - Intronic
1110126559 13:71950281-71950303 CTGCTAGCATTGTGTCTTCAGGG - Intergenic
1119249952 14:73143686-73143708 CTGTTAGCATAGGGTAAAAATGG + Intronic
1127621379 15:60737869-60737891 CTGCTAGAATTGTCACAAAAAGG - Intronic
1145914283 17:28562291-28562313 CTGGTTGCCTTGGGCCAAAAGGG + Intronic
1150056715 17:62023520-62023542 CTGCTGGAGTTGGCTCAAAAAGG + Intronic
1155228730 18:23753177-23753199 TTCCTAGCACAGGGTCAAAAAGG - Intronic
1159927577 18:74282593-74282615 CTGCTAGCAGAGGCACAAAACGG + Intronic
927984835 2:27402107-27402129 CTGCTAGCATTGGGTCAAAAAGG + Intronic
935135226 2:100294199-100294221 CTGTTAGCATTTGGTTCAAAGGG - Intronic
937453463 2:122021761-122021783 AGCCTAGCATTGGGTCAAATGGG + Intergenic
939566947 2:143796344-143796366 CTGGCAGCATTGGGCAAAAAAGG - Intergenic
945032164 2:205675769-205675791 CTGCTAACATTGAGTCAATCGGG + Intergenic
947278111 2:228417451-228417473 CTGCTCTCATTGGGTGAGAATGG + Intergenic
947760494 2:232600320-232600342 CTGCCAGGATGGGGCCAAAAGGG + Intergenic
947818477 2:233054201-233054223 CTTCTAGAATTGGGTTAAACCGG + Intergenic
948598552 2:239095754-239095776 CAGCCAGCACTGGGTCAAACAGG - Intronic
1171352944 20:24518687-24518709 CTGCTAGTATTGATTCACAAGGG + Intronic
1177080561 21:16633950-16633972 CTTCTGGAATTGGGTCAAAGTGG + Intergenic
1178525980 21:33329502-33329524 CTTATAGTATGGGGTCAAAAGGG - Intronic
952694526 3:36250050-36250072 CTGCTGGCATGGGCTCATAAGGG - Intergenic
961599680 3:128051334-128051356 CTGCTAGAAATGGGTGAGAATGG + Intergenic
963961227 3:151311546-151311568 TGGCTTGCATTAGGTCAAAACGG - Intronic
964035645 3:152193394-152193416 CTTTTAGCAGTGAGTCAAAAAGG - Intergenic
964840992 3:160993562-160993584 CTGCTTGCATTGGGTGAATTGGG + Intronic
972798474 4:42447021-42447043 TTGTTGGCATTGGGCCAAAAGGG + Intronic
974159648 4:58121404-58121426 ATGCTAGGAAAGGGTCAAAAGGG + Intergenic
975306799 4:72858832-72858854 CATCTTGCATTGGGTAAAAAGGG - Intergenic
980022190 4:127723053-127723075 CTGGTAGCATTGGCTCAGGAGGG + Exonic
980879586 4:138696266-138696288 CAGCTAGCATTTTATCAAAAAGG + Intergenic
982544780 4:156720828-156720850 CAGCTAGCATTGTGTCATAAAGG + Intergenic
991104013 5:62823855-62823877 CTGGTAGCAATGGGAAAAAAAGG - Intergenic
994135812 5:96284624-96284646 ATACTAGCATTGTGTAAAAAGGG + Intergenic
996068440 5:119106665-119106687 CTGCTAGCAGTGAGTTAGAAGGG + Intronic
997182724 5:131848133-131848155 CTGCTAGCTTTGGGTTTAGATGG - Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003421602 6:5963409-5963431 CTGCAAGGATTGGGGCAACATGG - Intergenic
1006415028 6:33898510-33898532 ATTCTAGCCTTGGGTCAAACGGG - Intergenic
1017070754 6:150573674-150573696 CTGCTGGCACTGGGTCAGCAGGG - Intergenic
1022851624 7:34268771-34268793 CTGCTAGCTTTCAGTGAAAAAGG - Intergenic
1024213823 7:47229486-47229508 CTGTTAGCATGGGGAAAAAAAGG + Intergenic
1030232169 7:107220329-107220351 ATTCTATCTTTGGGTCAAAATGG + Intronic
1031896504 7:127355380-127355402 CTGCTAGCCTTGGGTCTCAAAGG + Intronic
1033617300 7:143029051-143029073 GTGTTAGCATTGGGTCCAAGAGG + Intergenic
1042066416 8:64882180-64882202 CCTCTAGCTTTGAGTCAAAAGGG + Intergenic
1058164811 9:101607277-101607299 CTGCTAGAAATGGGGGAAAAAGG + Intronic
1058664702 9:107301032-107301054 CTGCTAACATTAAGTCAGAAAGG - Intronic
1191587168 X:62840694-62840716 GAGCTAGCATTGGTTCAAAGTGG - Intergenic
1197841998 X:130758124-130758146 ATGCTACCATTGGGAGAAAATGG - Intronic
1199686611 X:150270817-150270839 CTGTTAGCACTGGGTAAACAAGG - Intergenic
1200743091 Y:6876792-6876814 CTGCTGCCACTGGGCCAAAAAGG + Intergenic