ID: 927985746

View in Genome Browser
Species Human (GRCh38)
Location 2:27409379-27409401
Sequence CCCAACACGGTGAAGTGCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927985746_927985755 6 Left 927985746 2:27409379-27409401 CCGGAGCACTTCACCGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 927985755 2:27409408-27409430 GAGGTAGGCACCCATGGCGGCGG 0: 1
1: 0
2: 1
3: 38
4: 415
927985746_927985754 3 Left 927985746 2:27409379-27409401 CCGGAGCACTTCACCGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 927985754 2:27409405-27409427 GGAGAGGTAGGCACCCATGGCGG 0: 1
1: 0
2: 3
3: 13
4: 213
927985746_927985762 30 Left 927985746 2:27409379-27409401 CCGGAGCACTTCACCGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 927985762 2:27409432-27409454 TGGCCGGCGGCCTCAGGTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 179
927985746_927985756 10 Left 927985746 2:27409379-27409401 CCGGAGCACTTCACCGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 927985756 2:27409412-27409434 TAGGCACCCATGGCGGCGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 97
927985746_927985757 14 Left 927985746 2:27409379-27409401 CCGGAGCACTTCACCGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 927985757 2:27409416-27409438 CACCCATGGCGGCGGCTGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 138
927985746_927985752 -9 Left 927985746 2:27409379-27409401 CCGGAGCACTTCACCGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 927985752 2:27409393-27409415 CGTGTTGGGCTGGGAGAGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 286
927985746_927985753 0 Left 927985746 2:27409379-27409401 CCGGAGCACTTCACCGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 927985753 2:27409402-27409424 CTGGGAGAGGTAGGCACCCATGG 0: 1
1: 0
2: 0
3: 38
4: 358
927985746_927985760 17 Left 927985746 2:27409379-27409401 CCGGAGCACTTCACCGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 927985760 2:27409419-27409441 CCATGGCGGCGGCTGGCCGGCGG 0: 1
1: 0
2: 1
3: 21
4: 237
927985746_927985761 24 Left 927985746 2:27409379-27409401 CCGGAGCACTTCACCGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 927985761 2:27409426-27409448 GGCGGCTGGCCGGCGGCCTCAGG 0: 1
1: 0
2: 4
3: 19
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927985746 Original CRISPR CCCAACACGGTGAAGTGCTC CGG (reversed) Exonic
901270044 1:7945181-7945203 CCCAACACTGTGCAGTCCCCAGG + Intergenic
901334336 1:8436031-8436053 CCCAACACGGCCAGGTGCACTGG + Intronic
902214685 1:14926942-14926964 CCGAACACCTTGAATTGCTCAGG + Intronic
902291495 1:15438450-15438472 CCCAACATGGTTAGGTGCTCAGG - Exonic
903680974 1:25096703-25096725 CCCACCACGGAGAACTGCCCTGG + Intergenic
906718529 1:47988426-47988448 CACAACACAGTGAGGTGCTCTGG + Intronic
912550299 1:110481005-110481027 CACCACACTGTGAAGTGCTGGGG - Intergenic
912643840 1:111372420-111372442 CACCACAGGCTGAAGTGCTCTGG + Intergenic
916781389 1:168034262-168034284 CCCAACACTTTGGAGTGCTGAGG + Intronic
920130699 1:203729720-203729742 AGCAACACGGAGAAGTGCTCAGG - Intronic
1067218791 10:44326445-44326467 CCCAACATGGTGCACTGCTGTGG + Intergenic
1071031074 10:81182545-81182567 CCCAACACTGTTAAGTCCTCTGG + Intergenic
1072281632 10:93870939-93870961 CCCAACAGAGTGCAGTGTTCAGG + Intergenic
1077499512 11:2902833-2902855 CCCAACACAGTGCAGCTCTCAGG - Intronic
1083538953 11:63498302-63498324 CACCACAGGGTGAAGTGCTCTGG - Intergenic
1084638216 11:70407551-70407573 GCCAAGACGGTGCAGGGCTCCGG + Exonic
1086847893 11:91774238-91774260 CACCACAGGCTGAAGTGCTCTGG - Intergenic
1087313478 11:96577780-96577802 GCCAACATGCTAAAGTGCTCTGG - Intergenic
1098005854 12:65995986-65996008 CCCTACATGGTAAGGTGCTCAGG + Intergenic
1107339404 13:39389811-39389833 CCCAAGACAGTGCAGAGCTCAGG + Intronic
1117384346 14:55195633-55195655 CACAGCAGGCTGAAGTGCTCTGG - Intergenic
1123039624 14:105485198-105485220 CCCACCAGGATGACGTGCTCCGG - Intergenic
1130380002 15:83363407-83363429 CCTAACAGGGTGAAGTTCCCTGG - Intergenic
1135511888 16:23092432-23092454 CACCACACTGTGAAGTTCTCTGG - Intronic
1137579606 16:49625789-49625811 CTCAACATGGTGAATTCCTCAGG - Intronic
1137968409 16:52959414-52959436 GCCAACACAGTGAAATGCTGTGG - Intergenic
1142165963 16:88588286-88588308 CCCATCACAGTGCAGTGCTCTGG + Intronic
1147659796 17:42111462-42111484 CCCAGCATGGTGAAGAGTTCAGG - Exonic
1152374611 17:79912783-79912805 CCCAACTCGGGGTAGTGCTGGGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1166046227 19:40232638-40232660 CCCCACAGGATGAAATGCTCGGG + Exonic
1168401502 19:56088248-56088270 CCCAGCACGGGGACGGGCTCGGG - Exonic
925626953 2:5850907-5850929 CCTAACACAGTGAATGGCTCTGG + Intergenic
927985746 2:27409379-27409401 CCCAACACGGTGAAGTGCTCCGG - Exonic
930772474 2:55141711-55141733 CCCAGGAGGGTAAAGTGCTCTGG - Intergenic
931253257 2:60551340-60551362 ACCCAAAGGGTGAAGTGCTCGGG + Intronic
932401251 2:71482480-71482502 CCCAACACAGGGAAGCGCCCAGG - Intronic
942795986 2:179819617-179819639 CAGAACACTGTGAGGTGCTCAGG + Intronic
945211300 2:207385810-207385832 CCCAACCCTGTGGAATGCTCAGG - Intergenic
946776008 2:223142011-223142033 GCCAACAAGGAGGAGTGCTCGGG - Intronic
1175657634 20:60786007-60786029 CCCACCACGGGGAGGAGCTCAGG + Intergenic
1179906610 21:44426160-44426182 CCCACCCCGGTGAATGGCTCTGG + Intronic
957907686 3:86578771-86578793 CACTACAGGCTGAAGTGCTCTGG - Intergenic
958757933 3:98272267-98272289 CACCACAAGCTGAAGTGCTCTGG - Intergenic
969560407 4:7943205-7943227 CCCAGCACAGTGAAGTTCTAGGG + Intergenic
969673004 4:8599944-8599966 CCAACCAATGTGAAGTGCTCAGG + Intronic
977022863 4:91777442-91777464 GCCAAAACGGTGAGGTCCTCTGG + Intergenic
980172502 4:129306442-129306464 CACCACACGCTAAAGTGCTCTGG - Intergenic
980257568 4:130402331-130402353 CACCACACTGTGAAATGCTCTGG - Intergenic
980692942 4:136319820-136319842 CGCCACAGGCTGAAGTGCTCTGG + Intergenic
990406148 5:55493060-55493082 CCCAACACGTTGAAAGGCTGAGG + Intronic
994310163 5:98259939-98259961 CACCACAGGCTGAAGTGCTCTGG - Intergenic
997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG + Intronic
1005351121 6:24936815-24936837 TACAACACAGTGGAGTGCTCTGG - Intronic
1007760200 6:44128624-44128646 CCCAGGGCGGTGGAGTGCTCAGG - Intronic
1011434569 6:87322815-87322837 CCCAAGTCGGTGAAGCTCTCTGG + Intronic
1011598300 6:89037284-89037306 CACTACAGGCTGAAGTGCTCTGG + Intergenic
1011930823 6:92710179-92710201 CCCAAGACTGTGAAGTGTTTAGG - Intergenic
1014255860 6:119159629-119159651 CCCAGCATGGTGAAGTGGTGTGG - Intergenic
1020390760 7:7655447-7655469 CCCTATACAGTGAAGTTCTCTGG + Intronic
1024256968 7:47546481-47546503 CCCAGGACGGTGAGGTGCTGAGG + Intronic
1024698233 7:51878660-51878682 ACCAACAATGTGAAGTGGTCAGG + Intergenic
1027647605 7:80823268-80823290 CCCAATAAGGTTAAGTGCTACGG + Intronic
1028357378 7:89925729-89925751 CCCTACACTGTGAGCTGCTCAGG + Intergenic
1035365759 7:158348743-158348765 CCCAACAAGGTGAACAGTTCTGG + Intronic
1038445658 8:27602266-27602288 CCAAACACCCTGAACTGCTCAGG + Intronic
1042584689 8:70322847-70322869 GCCAAAAAAGTGAAGTGCTCAGG + Intronic
1042898292 8:73694980-73695002 CACCACAGGCTGAAGTGCTCCGG + Intronic
1046489120 8:114924610-114924632 GCCAACACAGTCAAGTGCTGTGG - Intergenic
1048303425 8:133267428-133267450 CCCAACACCGTTAAGTCCCCTGG + Intronic
1050276470 9:4006467-4006489 CTCAACTCAGTGATGTGCTCGGG - Intronic
1055496972 9:76865240-76865262 CCCAACACTGTGAAAGGCTGAGG + Intronic
1056518328 9:87375943-87375965 CCCAACACTGTGGAATGCTGAGG + Intergenic
1059053120 9:110950207-110950229 CCCAGCACTGTGAAGGGCTGAGG + Intronic
1062730168 9:138104170-138104192 CCCTCCAAGGTGCAGTGCTCTGG - Intronic
1185871680 X:3670019-3670041 CCCAACACCCTGAAGTGTGCAGG + Intronic
1189220478 X:39367680-39367702 GCCAACCCAGTGAAGTGCTGTGG + Intergenic
1194415396 X:93605919-93605941 CACCACAAGCTGAAGTGCTCTGG + Intergenic
1195017907 X:100796797-100796819 CCCATCACTGTGAAGTTCACAGG - Intergenic
1198947654 X:142032055-142032077 CACAACAGGCTAAAGTGCTCTGG - Intergenic
1201291398 Y:12423737-12423759 CTCAACACGCTGTAGTGCACAGG - Intergenic