ID: 927988196

View in Genome Browser
Species Human (GRCh38)
Location 2:27428556-27428578
Sequence ACCGCCGGCAGGTTTCCATT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988196_927988207 13 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28
927988196_927988203 3 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988196_927988209 17 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988209 2:27428596-27428618 TGGTCCGGGCGCCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 115
927988196_927988202 2 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988196_927988208 14 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21
927988196_927988201 -3 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988196_927988211 19 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988211 2:27428598-27428620 GTCCGGGCGCCGCGAGGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 226
927988196_927988210 18 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988210 2:27428597-27428619 GGTCCGGGCGCCGCGAGGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988196 Original CRISPR ACCGCCGGCAGGTTTCCATT GGG (reversed) Exonic