ID: 927988197

View in Genome Browser
Species Human (GRCh38)
Location 2:27428557-27428579
Sequence CACCGCCGGCAGGTTTCCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 35}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988197_927988214 30 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988214 2:27428610-27428632 CGAGGGCGGGGCCCGCAGTTCGG 0: 1
1: 0
2: 1
3: 10
4: 96
927988197_927988211 18 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988211 2:27428598-27428620 GTCCGGGCGCCGCGAGGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 226
927988197_927988210 17 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988210 2:27428597-27428619 GGTCCGGGCGCCGCGAGGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 289
927988197_927988202 1 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988197_927988201 -4 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988197_927988209 16 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988209 2:27428596-27428618 TGGTCCGGGCGCCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 115
927988197_927988203 2 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988197_927988208 13 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21
927988197_927988207 12 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988197 Original CRISPR CACCGCCGGCAGGTTTCCAT TGG (reversed) Exonic
902329674 1:15725190-15725212 CACCCCTGTCAGGTTTCCCTGGG + Intronic
917217225 1:172690977-172690999 AACCTCTGGCAGGCTTCCATAGG - Intergenic
1074611279 10:115024590-115024612 CACCGCCTGAAGGGTTACATTGG + Intergenic
1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG + Exonic
1084036084 11:66511202-66511224 CAGCGCTGGCAGATTTACATGGG + Exonic
1101799597 12:108009235-108009257 CACAGCCGAAAGCTTTCCATTGG + Intergenic
1115596146 14:34911162-34911184 CACCGCTGGCAGGTATTCTTGGG + Intergenic
1119840549 14:77789605-77789627 CACCTCCTGCAGTTTTCCAGTGG - Intergenic
1131909579 15:97182742-97182764 CAGCGATGGCAGGATTCCATGGG - Intergenic
1137396133 16:48117258-48117280 CACCTCAGTCAGGTCTCCATAGG + Exonic
1141532565 16:84656983-84657005 CACGGCCAGCAGGTTGCGATGGG - Exonic
1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG + Intronic
1147886739 17:43689331-43689353 CACCCCGGGGAGGTTTCCCTTGG + Intergenic
1161298482 19:3531709-3531731 CACCGCCACCAGGTTCCCCTAGG - Exonic
1162572779 19:11482445-11482467 CGGAGCCGGCAGGTTTCCATGGG - Intronic
1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG + Intergenic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1168436542 19:56322373-56322395 CTCAGCCGGCAGGCTTCCCTAGG + Intronic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG + Intronic
938388787 2:130887851-130887873 CCACGCCGGCAGGGTTTCATGGG + Intronic
940650379 2:156435729-156435751 CCCGGCCGGCAGGCTTCCCTAGG - Exonic
1174584794 20:51600060-51600082 CACTGCCGGCAGATTTCAAGGGG - Exonic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1180134509 21:45853544-45853566 TACCCTCTGCAGGTTTCCATTGG + Intronic
961509380 3:127391697-127391719 CACCGACACCAGGCTTCCATGGG + Intergenic
968810470 4:2797481-2797503 GACCGCTGGCAGGTGCCCATGGG + Intronic
972475567 4:39446549-39446571 CACCGCGGACAGGTTGCCAGTGG - Exonic
972679946 4:41295681-41295703 CACAGCCGCCAAGTTTCCAGGGG - Intergenic
984585101 4:181554254-181554276 CACCGCCCGCAGCTTTTCAGTGG - Intergenic
986342806 5:6805599-6805621 GACTGCCAGCAAGTTTCCATGGG - Intergenic
1014146458 6:118003422-118003444 CACAGCCGGCAGGTTGCCATGGG - Intronic
1017773433 6:157661169-157661191 CACCACCCCCAGGTATCCATGGG - Intronic
1019519341 7:1453663-1453685 CACAGCCTGCAGGTTTGCAGCGG - Intronic
1033306888 7:140231466-140231488 CACGGCCCGCGGGCTTCCATTGG - Intergenic
1049860290 8:144893672-144893694 CACCTCTGCCAGGTTTCCAGGGG - Intronic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1197370712 X:125622213-125622235 TACTGCTGGTAGGTTTCCATAGG + Intergenic