ID: 927988201

View in Genome Browser
Species Human (GRCh38)
Location 2:27428576-27428598
Sequence GGTGCGGCACCGCCCATCGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988188_927988201 16 Left 927988188 2:27428537-27428559 CCGCCCACCCAGAACGTCACCCA 0: 1
1: 0
2: 1
3: 15
4: 200
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988192_927988201 9 Left 927988192 2:27428544-27428566 CCCAGAACGTCACCCAATGGAAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988190_927988201 12 Left 927988190 2:27428541-27428563 CCACCCAGAACGTCACCCAATGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988193_927988201 8 Left 927988193 2:27428545-27428567 CCAGAACGTCACCCAATGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988186_927988201 18 Left 927988186 2:27428535-27428557 CCCCGCCCACCCAGAACGTCACC 0: 1
1: 0
2: 3
3: 86
4: 728
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988197_927988201 -4 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988189_927988201 13 Left 927988189 2:27428540-27428562 CCCACCCAGAACGTCACCCAATG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988196_927988201 -3 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988185_927988201 23 Left 927988185 2:27428530-27428552 CCGGGCCCCGCCCACCCAGAACG 0: 1
1: 0
2: 1
3: 34
4: 296
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988187_927988201 17 Left 927988187 2:27428536-27428558 CCCGCCCACCCAGAACGTCACCC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23
927988184_927988201 30 Left 927988184 2:27428523-27428545 CCGAGGGCCGGGCCCCGCCCACC 0: 1
1: 0
2: 4
3: 53
4: 589
Right 927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988201 Original CRISPR GGTGCGGCACCGCCCATCGT TGG Exonic
914755937 1:150561638-150561660 CCTGCGGCACCGCCCCTCCTGGG - Intergenic
1074618381 10:115093148-115093170 GGGGCGGCCCCACGCATCGTGGG + Intergenic
1077976277 11:7251913-7251935 TGTGCGGCACCGCCTCTCCTCGG + Intronic
1123505863 15:20941154-20941176 GGGGCTGCACTGCCCATGGTGGG + Intergenic
1123563095 15:21514860-21514882 GGGGCTGCACTGCCCATGGTGGG + Intergenic
1123599344 15:21952143-21952165 GGGGCTGCACTGCCCATGGTGGG + Intergenic
1202971448 15_KI270727v1_random:241994-242016 GGGGCTGCACTGCCCATGGTGGG + Intergenic
1142281357 16:89149680-89149702 GGTGCTGAACCGCCCAGAGTTGG + Intronic
1146339513 17:32007354-32007376 GGTGCGCCGCCGCCCAGCCTGGG - Intergenic
1154170511 18:12047448-12047470 GGGGCTGCACTGCCCATCATGGG - Intergenic
1154170540 18:12047545-12047567 GGGGCTGCACTGCCCATGGTGGG - Intergenic
1154415976 18:14175408-14175430 GGGGCTGCACTGCCCATGGTGGG - Intergenic
1154416523 18:14178505-14178527 GGGACGGCACTGCCCATCGTGGG + Intergenic
1163847910 19:19647570-19647592 GGTGCAGCACCTCCCCTCTTGGG + Intronic
927988201 2:27428576-27428598 GGTGCGGCACCGCCCATCGTTGG + Exonic
1176856805 21:13980753-13980775 GGGAGGGCACTGCCCATCGTGGG - Intergenic
1176857369 21:13983886-13983908 GGGGCTGCACTGCCCATGGTGGG + Intergenic
1176867242 21:14060340-14060362 GGGGCTGCACTGCCCATGGTGGG - Intergenic
1180305084 22:11067238-11067260 GGTGCTGCAACACCCATGGTGGG + Intergenic
952416828 3:33097157-33097179 GGCCTGGCACCGCCCCTCGTCGG + Exonic
968912990 4:3485237-3485259 AGTGCTGCCCCGCCCATCCTAGG - Intronic
989026300 5:37072370-37072392 GGTGCAGCACAGCTCATAGTAGG - Intergenic
1019721794 7:2576905-2576927 GGTGCGGCACCGTCCAGCCCCGG + Intronic
1032091561 7:128914109-128914131 GCTGAGGCACAGCCCATCTTGGG - Intergenic
1053137252 9:35658762-35658784 GGTGCGGGACCGCCGGGCGTGGG + Intronic