ID: 927988202

View in Genome Browser
Species Human (GRCh38)
Location 2:27428581-27428603
Sequence GGCACCGCCCATCGTTGGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 19}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988185_927988202 28 Left 927988185 2:27428530-27428552 CCGGGCCCCGCCCACCCAGAACG 0: 1
1: 0
2: 1
3: 34
4: 296
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988188_927988202 21 Left 927988188 2:27428537-27428559 CCGCCCACCCAGAACGTCACCCA 0: 1
1: 0
2: 1
3: 15
4: 200
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988190_927988202 17 Left 927988190 2:27428541-27428563 CCACCCAGAACGTCACCCAATGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988197_927988202 1 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988192_927988202 14 Left 927988192 2:27428544-27428566 CCCAGAACGTCACCCAATGGAAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988187_927988202 22 Left 927988187 2:27428536-27428558 CCCGCCCACCCAGAACGTCACCC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988186_927988202 23 Left 927988186 2:27428535-27428557 CCCCGCCCACCCAGAACGTCACC 0: 1
1: 0
2: 3
3: 86
4: 728
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988196_927988202 2 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988193_927988202 13 Left 927988193 2:27428545-27428567 CCAGAACGTCACCCAATGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988189_927988202 18 Left 927988189 2:27428540-27428562 CCCACCCAGAACGTCACCCAATG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19
927988199_927988202 -9 Left 927988199 2:27428567-27428589 CCTGCCGGCGGTGCGGCACCGCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988202 Original CRISPR GGCACCGCCCATCGTTGGTC CGG Exonic
900379447 1:2376605-2376627 GGCTCCTCCCATGGTTGGTCTGG + Intronic
903792558 1:25905467-25905489 GGCCACGCCCATCCTGGGTCCGG - Intronic
1077247969 11:1548320-1548342 GGCCCCGCCCACTGTTGGGCAGG + Intergenic
1086058866 11:82680233-82680255 GGCACCTCCCAAAGTTGGTTTGG - Intergenic
1102005974 12:109589431-109589453 GGCACCACGCATGGTTGGTGGGG - Intronic
1132811979 16:1804457-1804479 GGCACCGCCTCTTGTTGGTGTGG - Intronic
1139753051 16:69120741-69120763 GGCACCTCCAATCCCTGGTCTGG + Intronic
1145053568 17:19682923-19682945 GGCACAGCTCATCCTTGGTCAGG + Intronic
1167286458 19:48601256-48601278 GGCACCGCCCCACGGAGGTCGGG + Exonic
927988202 2:27428581-27428603 GGCACCGCCCATCGTTGGTCCGG + Exonic
928947635 2:36786094-36786116 GGCACTGCCCATTGTGGGTGGGG - Intronic
929955148 2:46452237-46452259 GGCATTGCCCACAGTTGGTCTGG - Intronic
1172847105 20:37936180-37936202 GGCACCGCGCCTGGTTGGTGTGG + Intronic
1179841594 21:44079311-44079333 AGCACAACACATCGTTGGTCTGG - Intronic
1180135600 21:45859974-45859996 GGCACCGGCCATCCCTGGGCTGG - Intronic
1181167289 22:20990662-20990684 GGCACCGCACATCCCTGCTCCGG - Intronic
1183651039 22:39153236-39153258 GGCACCGACCACCGAGGGTCGGG - Intergenic
975820611 4:78267106-78267128 GACCCTGCCCATCGTGGGTCGGG + Intronic
995271744 5:110227830-110227852 GGCACCGCCCATGGTGGGCAGGG - Intergenic
1016941038 6:149482909-149482931 GGCACCGCCCAGGGCTGCTCAGG + Intronic
1027230244 7:76268032-76268054 GGCACCGCCCACACTTGGACTGG + Intronic
1035481500 7:159190916-159190938 TGCACCCACCATCGTGGGTCAGG + Intergenic
1043866407 8:85380151-85380173 GGCACTGCCCATAGTTGGTTGGG + Intronic