ID: 927988203

View in Genome Browser
Species Human (GRCh38)
Location 2:27428582-27428604
Sequence GCACCGCCCATCGTTGGTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988190_927988203 18 Left 927988190 2:27428541-27428563 CCACCCAGAACGTCACCCAATGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988185_927988203 29 Left 927988185 2:27428530-27428552 CCGGGCCCCGCCCACCCAGAACG 0: 1
1: 0
2: 1
3: 34
4: 296
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988197_927988203 2 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988193_927988203 14 Left 927988193 2:27428545-27428567 CCAGAACGTCACCCAATGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988196_927988203 3 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988189_927988203 19 Left 927988189 2:27428540-27428562 CCCACCCAGAACGTCACCCAATG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988187_927988203 23 Left 927988187 2:27428536-27428558 CCCGCCCACCCAGAACGTCACCC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988188_927988203 22 Left 927988188 2:27428537-27428559 CCGCCCACCCAGAACGTCACCCA 0: 1
1: 0
2: 1
3: 15
4: 200
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988192_927988203 15 Left 927988192 2:27428544-27428566 CCCAGAACGTCACCCAATGGAAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988199_927988203 -8 Left 927988199 2:27428567-27428589 CCTGCCGGCGGTGCGGCACCGCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
927988186_927988203 24 Left 927988186 2:27428535-27428557 CCCCGCCCACCCAGAACGTCACC 0: 1
1: 0
2: 3
3: 86
4: 728
Right 927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988203 Original CRISPR GCACCGCCCATCGTTGGTCC GGG Exonic
900379448 1:2376606-2376628 GCTCCTCCCATGGTTGGTCTGGG + Intronic
900511008 1:3061164-3061186 GCACAGCCCAGCCTTGGGCCAGG + Intergenic
901644647 1:10709917-10709939 CCACCGCCCCTCCCTGGTCCGGG - Intronic
904997080 1:34639656-34639678 GCTCTGCCCAGGGTTGGTCCTGG + Intergenic
905976842 1:42181837-42181859 TCACCTGCCATCGTTGTTCCTGG + Intronic
907330437 1:53667490-53667512 GCCCGGCCCTTCCTTGGTCCTGG + Intronic
922582854 1:226711657-226711679 GGACCTCCCATCATTTGTCCTGG + Intronic
1071561541 10:86649904-86649926 GCTCTGCCCCTCGTTGCTCCAGG - Intergenic
1075421200 10:122301903-122301925 GCACCCCTCGTCGTTGGTCATGG + Intronic
1079012179 11:16837898-16837920 GCACCACCGATAGTTGGGCCTGG - Intronic
1081569440 11:44280452-44280474 ACAGCGCCCAGCGTGGGTCCAGG + Intronic
1089644820 11:119871832-119871854 GCAACTCCCTTCGTTGGTGCTGG - Intergenic
1105462722 13:20607202-20607224 GCACCGCCCATCTCAGGCCCCGG + Intronic
1138992508 16:62409004-62409026 GCTCGGCCCACGGTTGGTCCAGG + Intergenic
1152602299 17:81270545-81270567 CCACCACCCACCGTTGTTCCTGG - Intronic
1158338866 18:56444072-56444094 GCAAGGCCCATGGTTGATCCTGG + Intergenic
1162732767 19:12728925-12728947 GGACCCCCCAACGTTGCTCCAGG + Intergenic
1164159705 19:22618212-22618234 GCCTCGCCCATCGCTGGCCCCGG + Intergenic
927988203 2:27428582-27428604 GCACCGCCCATCGTTGGTCCGGG + Exonic
931839337 2:66132089-66132111 GCACCGCCCAGAGTTATTCCAGG + Intergenic
939490260 2:142868393-142868415 GCACAGCCCATAGTGGGACCGGG + Intergenic
1180147063 21:45927603-45927625 GCACCGCCCAGTGCTAGTCCAGG + Intronic
1181167288 22:20990661-20990683 GCACCGCACATCCCTGCTCCGGG - Intronic
1185323678 22:50215387-50215409 GCCCCGCTCAGCATTGGTCCTGG - Intronic
950261136 3:11544101-11544123 ACACCGGCCATCCTTGGCCCAGG + Intronic
952878203 3:37965901-37965923 GCCCCTTCCATAGTTGGTCCAGG + Intronic
963447184 3:145427565-145427587 GCTCAGCCCATTGTTGGACCTGG + Intergenic
974104435 4:57453814-57453836 GCACCTGCCATAATTGGTCCAGG - Intergenic
986336027 5:6756134-6756156 GCACAGCCCAGCGTTGGGGCCGG + Exonic
1005928413 6:30463846-30463868 GCCCCGCCCAGCGGTGGCCCAGG + Intergenic
1007775838 6:44223846-44223868 GCCCCGCCCAGCTTGGGTCCCGG - Exonic
1022501484 7:30884747-30884769 GCACCTCCCAGCGTGGGCCCAGG + Intronic
1024678674 7:51661143-51661165 GCAATGCCCATGGTGGGTCCAGG + Intergenic
1034559270 7:151869679-151869701 GCACGGCCCAGTGCTGGTCCTGG - Intronic
1045489288 8:102656478-102656500 GCCCCGCCCATCCTTCCTCCTGG + Intergenic
1057805122 9:98214681-98214703 GCACAGCCCACAGGTGGTCCTGG + Intronic