ID: 927988207

View in Genome Browser
Species Human (GRCh38)
Location 2:27428592-27428614
Sequence TCGTTGGTCCGGGCGCCGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 28}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988197_927988207 12 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28
927988193_927988207 24 Left 927988193 2:27428545-27428567 CCAGAACGTCACCCAATGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28
927988192_927988207 25 Left 927988192 2:27428544-27428566 CCCAGAACGTCACCCAATGGAAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28
927988190_927988207 28 Left 927988190 2:27428541-27428563 CCACCCAGAACGTCACCCAATGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28
927988196_927988207 13 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28
927988189_927988207 29 Left 927988189 2:27428540-27428562 CCCACCCAGAACGTCACCCAATG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28
927988200_927988207 -2 Left 927988200 2:27428571-27428593 CCGGCGGTGCGGCACCGCCCATC 0: 1
1: 0
2: 0
3: 7
4: 44
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28
927988199_927988207 2 Left 927988199 2:27428567-27428589 CCTGCCGGCGGTGCGGCACCGCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988207 Original CRISPR TCGTTGGTCCGGGCGCCGCG AGG Exonic
906508035 1:46394435-46394457 GCGCTGGTCCGGGCGCCGGACGG + Exonic
922307582 1:224357304-224357326 GGGCTGGTCCGGGCGCCGCGGGG - Intronic
922950967 1:229558410-229558432 GCGGGGGTCCGGGCGCCTCGCGG - Exonic
1074618708 10:115094249-115094271 CCGTTGGTCAGGGCTCCGCGCGG - Intronic
1077410117 11:2400004-2400026 GCATTGGTCCGGGCTCCGGGAGG - Intergenic
1079128514 11:17734905-17734927 TGGCGGGTCCGGGCGCGGCGAGG - Exonic
1079238395 11:18705800-18705822 TCTATGGTGAGGGCGCCGCGGGG - Exonic
1084295961 11:68213534-68213556 TCCCAGGTCCGTGCGCCGCGCGG + Intronic
1105414095 13:20193757-20193779 TGGCTGGGCCGGGGGCCGCGGGG - Intergenic
1143643066 17:8210583-8210605 TCCTTGGCCAGGGCGCGGCGTGG - Intronic
1147758006 17:42780964-42780986 CCGCTGGTCCTGGCCCCGCGAGG + Exonic
1147788612 17:42998527-42998549 TCGAAGGTCCGGGCGGCGCCGGG + Exonic
1165148615 19:33748417-33748439 TCGTTGGTGCCAGCGCCGCTGGG + Intronic
927988207 2:27428592-27428614 TCGTTGGTCCGGGCGCCGCGAGG + Exonic
939004126 2:136765957-136765979 TCGGTGCTCAGGTCGCCGCGTGG - Intronic
1168765800 20:381131-381153 GCGTGGGCCCGGGCGCCGCCGGG - Exonic
1173848185 20:46201139-46201161 ACGCTGGTGGGGGCGCCGCGAGG + Intronic
1183876751 22:40789307-40789329 TCCGGGGTCCGGGCACCGCGTGG - Intronic
1184680979 22:46071980-46072002 GCGTGGGCCCGGCCGCCGCGCGG - Intronic
1185335889 22:50270658-50270680 TCGTTGGGGAGGGCGCCGCCGGG - Intronic
980541468 4:134201612-134201634 TCCTTTCTCCGGGCGCCGCGCGG - Intronic
992325167 5:75653264-75653286 GCTTTGGTCCTGGCGCCGTGAGG + Intronic
1007558210 6:42783553-42783575 TCGATGACCAGGGCGCCGCGAGG + Intronic
1041076512 8:54174828-54174850 GCGTGGGTGCGGGCGCAGCGGGG - Intergenic
1044821688 8:96159752-96159774 CCCCTGGTCCTGGCGCCGCGCGG - Intronic
1053424709 9:38003442-38003464 TCGTGGGACGGGGAGCCGCGGGG - Intronic
1057883054 9:98807801-98807823 TCGGTGCTGCGGGCGCAGCGTGG + Exonic
1061575650 9:131504101-131504123 TCGTGTGTCCGGGAGCCGGGTGG + Intronic
1185431639 X:14746-14768 TCGTGGGCCCGGGCGCTGGGTGG - Intergenic
1185432902 X:19761-19783 TCGTGGGCCCGGGCGCTGGGTGG - Intergenic
1185440963 X:227465-227487 TCGTGGGCCCGGGCGCTGGGTGG - Intergenic
1185442254 X:232583-232605 TCGTGGGCCCGGGCGCTGGGTGG - Intergenic