ID: 927988208

View in Genome Browser
Species Human (GRCh38)
Location 2:27428593-27428615
Sequence CGTTGGTCCGGGCGCCGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 21}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988192_927988208 26 Left 927988192 2:27428544-27428566 CCCAGAACGTCACCCAATGGAAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21
927988197_927988208 13 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21
927988189_927988208 30 Left 927988189 2:27428540-27428562 CCCACCCAGAACGTCACCCAATG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21
927988196_927988208 14 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21
927988199_927988208 3 Left 927988199 2:27428567-27428589 CCTGCCGGCGGTGCGGCACCGCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21
927988193_927988208 25 Left 927988193 2:27428545-27428567 CCAGAACGTCACCCAATGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21
927988190_927988208 29 Left 927988190 2:27428541-27428563 CCACCCAGAACGTCACCCAATGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21
927988200_927988208 -1 Left 927988200 2:27428571-27428593 CCGGCGGTGCGGCACCGCCCATC 0: 1
1: 0
2: 0
3: 7
4: 44
Right 927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988208 Original CRISPR CGTTGGTCCGGGCGCCGCGA GGG Exonic
901540183 1:9910379-9910401 CGTGGGGCCGGGCGCCGGGGCGG + Intergenic
906640281 1:47437456-47437478 CGGTGGCCCGGGCGCCGCCTTGG + Exonic
922950966 1:229558409-229558431 CGGGGGTCCGGGCGCCTCGCGGG - Exonic
1072881591 10:99234175-99234197 TGTTGGTGCGGTTGCCGCGAGGG - Intronic
1073414360 10:103368567-103368589 GGTAGGTACGGCCGCCGCGAAGG + Intronic
1074618707 10:115094248-115094270 CGTTGGTCAGGGCTCCGCGCGGG - Intronic
1077315892 11:1919221-1919243 CATTGGGCCGGGCGGCGGGAGGG + Intergenic
1109512416 13:63396740-63396762 CGTAGGTCCGGGCTCCCCAAAGG - Intergenic
1122978592 14:105181206-105181228 CGCCTGTCCGGGCGCCGCCATGG - Exonic
1136221884 16:28834514-28834536 TGTTGGTCCGAGCGCTGCGGAGG - Exonic
1139606596 16:68023137-68023159 GGTTGCTCCTGGCGCCGCGACGG - Exonic
1142211765 16:88811781-88811803 CGCAGGTCGGGGCGCCACGAGGG + Intronic
1160864039 19:1249438-1249460 CATTGTTCCCGGCGCCGGGAGGG - Intronic
927988208 2:27428593-27428615 CGTTGGTCCGGGCGCCGCGAGGG + Exonic
1168765799 20:381130-381152 CGTGGGCCCGGGCGCCGCCGGGG - Exonic
1175927088 20:62476191-62476213 CACTGGTCCGGGCTCCGCGCTGG - Intergenic
1176104678 20:63380403-63380425 CCTTGGTCTGGGCTCCCCGAAGG - Intergenic
980541466 4:134201611-134201633 CCTTTCTCCGGGCGCCGCGCGGG - Intronic
1022285941 7:28956448-28956470 CGTTGGGGTGGGCTCCGCGAGGG + Exonic
1031997223 7:128240852-128240874 CGTTGGTCCTGGCGCGGCTTCGG - Intergenic
1033406443 7:141074237-141074259 CTTTGTTCCGGGTGCGGCGAGGG + Exonic
1037143111 8:15540686-15540708 CGCTGGGGCGGGAGCCGCGAGGG + Intronic
1044821686 8:96159751-96159773 CCCTGGTCCTGGCGCCGCGCGGG - Intronic
1190277998 X:48911589-48911611 CCCTGGCCCGGGCGCCGCGGTGG + Exonic