ID: 927988209

View in Genome Browser
Species Human (GRCh38)
Location 2:27428596-27428618
Sequence TGGTCCGGGCGCCGCGAGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988193_927988209 28 Left 927988193 2:27428545-27428567 CCAGAACGTCACCCAATGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 927988209 2:27428596-27428618 TGGTCCGGGCGCCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 115
927988192_927988209 29 Left 927988192 2:27428544-27428566 CCCAGAACGTCACCCAATGGAAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 927988209 2:27428596-27428618 TGGTCCGGGCGCCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 115
927988197_927988209 16 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988209 2:27428596-27428618 TGGTCCGGGCGCCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 115
927988199_927988209 6 Left 927988199 2:27428567-27428589 CCTGCCGGCGGTGCGGCACCGCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 927988209 2:27428596-27428618 TGGTCCGGGCGCCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 115
927988200_927988209 2 Left 927988200 2:27428571-27428593 CCGGCGGTGCGGCACCGCCCATC 0: 1
1: 0
2: 0
3: 7
4: 44
Right 927988209 2:27428596-27428618 TGGTCCGGGCGCCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 115
927988196_927988209 17 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988209 2:27428596-27428618 TGGTCCGGGCGCCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988209 Original CRISPR TGGTCCGGGCGCCGCGAGGG CGG Exonic
900512823 1:3068503-3068525 GGGGCCGGGAGGCGCGAGGGGGG + Intergenic
903519112 1:23934057-23934079 TGGTCCAGGTGCTGGGAGGGTGG - Intergenic
904706440 1:32394483-32394505 TGGGCCGAGCGCCTCGGGGGCGG - Intronic
913274126 1:117121550-117121572 TGGGGCGGGCGGCGGGAGGGGGG - Exonic
913581620 1:120232847-120232869 GGGTCGGGGAGACGCGAGGGTGG + Intergenic
913626557 1:120665541-120665563 GGGTCGGGGAGACGCGAGGGTGG - Intergenic
914563552 1:148844294-148844316 GGGTCGGGGAGACGCGAGGGTGG + Intronic
914609275 1:149285931-149285953 GGGTCGGGGAGACGCGAGGGTGG - Intergenic
915722262 1:157993837-157993859 GGGTCCGGACGCCACGAGGCGGG + Intronic
916051358 1:161038932-161038954 TGTTGCAGGCGCCGAGAGGGCGG - Exonic
916063521 1:161118287-161118309 TGGAGCGGGCGGCGGGAGGGTGG + Intronic
917974450 1:180230035-180230057 GGGTCCCGGCGCCCCGAGTGAGG - Intergenic
1062857106 10:784840-784862 TGCCCCGGGCGCTGCGGGGGCGG - Intergenic
1065025147 10:21534277-21534299 TGGGCCAGGGGCAGCGAGGGAGG - Intronic
1072881590 10:99234172-99234194 TGGTGCGGTTGCCGCGAGGGCGG - Intronic
1075129562 10:119726320-119726342 TGGTGCAGCCGCCGCGACGGCGG + Exonic
1077220019 11:1411655-1411677 TGGCCAGGGCCCCTCGAGGGAGG + Intronic
1081607266 11:44535268-44535290 GGATCTGGGCGCCTCGAGGGCGG + Intergenic
1089311462 11:117560914-117560936 TGGTCCAGGCCCCACCAGGGTGG - Intronic
1089494195 11:118900169-118900191 TGCTCCGGGGGCCGCTAGGCGGG + Exonic
1089500004 11:118926098-118926120 TGGCCCGGGGGCGGGGAGGGGGG + Intronic
1089842106 11:121427325-121427347 TGGGCCGGGCGCTGCGGGGCCGG - Intergenic
1090785015 11:130041026-130041048 TGCCCAGGGCGCCGCGAGTGGGG - Intergenic
1097383269 12:58920349-58920371 TTGACCGGGCAGCGCGAGGGAGG - Exonic
1097981747 12:65742548-65742570 TGGCCCGGCCGCGGCGGGGGTGG - Intergenic
1101013606 12:100476227-100476249 TGATCGGGGAGCGGCGAGGGGGG + Intronic
1105964514 13:25372295-25372317 TGGGAGGGGCGCGGCGAGGGAGG + Intronic
1110558387 13:76885709-76885731 TGCACCCCGCGCCGCGAGGGCGG + Exonic
1113932276 13:113974693-113974715 TCGTCCTGGCGCCGTGTGGGTGG - Intergenic
1114527386 14:23375380-23375402 TGGTCCTGGGACCGTGAGGGAGG - Intronic
1115852645 14:37599812-37599834 GGTTCCGGGGGCCTCGAGGGAGG - Intronic
1117014655 14:51506282-51506304 TGTTCTGGGCGCTGAGAGGGAGG - Intronic
1118616037 14:67575064-67575086 TTGTCAGGGTGCCGGGAGGGAGG - Intronic
1122300135 14:100726833-100726855 GGGGGCGGGGGCCGCGAGGGGGG + Exonic
1122817538 14:104320973-104320995 TGGCCTGGGCTCCGCCAGGGAGG + Intergenic
1123024988 14:105420171-105420193 GGAGCCGGGGGCCGCGAGGGCGG - Intronic
1125509057 15:40283094-40283116 TGGCCCGGCCCCCGCGAGAGGGG - Intronic
1125626829 15:41115984-41116006 TGGCCCCGCCGCCGCGACGGCGG + Exonic
1128501450 15:68229820-68229842 AGGGCCGGGCGCTGCGAGTGTGG + Intronic
1132915705 16:2342008-2342030 TGGTCCCGGCGCCCCGGGTGAGG + Intergenic
1134084252 16:11345728-11345750 TGGAGCGGGTGCCGCGCGGGCGG + Exonic
1135135661 16:19884320-19884342 TGGTCCTGGGGCCGCGTTGGGGG - Intronic
1135807241 16:25554033-25554055 TGGTCGGGGGGCAGCTAGGGTGG - Intergenic
1139664909 16:68448551-68448573 TGGCTCCGGCGGCGCGAGGGAGG - Exonic
1141430619 16:83968791-83968813 TGGGCCGGGGTCCGCGGGGGCGG - Exonic
1142037256 16:87869734-87869756 TGACGCGGGCGCCGGGAGGGGGG - Intergenic
1142179922 16:88663383-88663405 GGGTCTGGGCGCGGCGAGGTGGG + Intergenic
1142211766 16:88811784-88811806 AGGTCGGGGCGCCACGAGGGCGG + Intronic
1142254108 16:89005820-89005842 GGGTCCGGGTGCCACGAGAGTGG + Intergenic
1142541248 17:661081-661103 TGGTCCTGGAGCCGGGAGGAGGG - Intronic
1143295720 17:5870445-5870467 TGGTGTGGGCGCAGGGAGGGCGG - Intronic
1150840433 17:68601191-68601213 TGGCACGGGCGGCGCGAGTGGGG + Exonic
1151744628 17:76005250-76005272 TGGTCTGGGTGCAGCCAGGGTGG - Intronic
1151779978 17:76239731-76239753 GGGTCCGAGGGCCGCGAGGGAGG - Intronic
1152870693 17:82751721-82751743 GGGGCCGGGGGCCGCCAGGGCGG - Intergenic
1154214741 18:12407897-12407919 GGCTCCGGGCGCGGCGTGGGCGG - Exonic
1155928918 18:31685512-31685534 TGTTTCGGGCGCGGGGAGGGCGG - Intronic
1160896001 19:1402212-1402234 TGGTCTGGTGGCCACGAGGGTGG + Intergenic
1161212742 19:3076093-3076115 CGGCACGGGCGCCGCGTGGGTGG - Intergenic
1161777531 19:6271825-6271847 TGGTCTGGGGCCCGGGAGGGCGG - Intronic
1161925261 19:7294527-7294549 TGTGCCGGGCCCCGCGCGGGAGG + Intergenic
1162296613 19:9818493-9818515 GGGTCCGGGCACCGCGACCGCGG + Intronic
1163129666 19:15264678-15264700 GGCTCCGGGGGCAGCGAGGGTGG + Exonic
1163420694 19:17212131-17212153 TGGTCCGGGCGGCGGGCAGGTGG - Exonic
1165129172 19:33621697-33621719 CGGTCCGGCGGCCGCGGGGGTGG - Intergenic
1165157264 19:33796243-33796265 AGGCCCGGGCGCCGCGTGGCCGG + Intronic
1166347715 19:42176767-42176789 GGCGCCGGGCGCCGAGAGGGAGG + Intronic
1168536062 19:57171995-57172017 GGGGCCGCGGGCCGCGAGGGGGG + Intergenic
927811686 2:26184112-26184134 TAGTCCGAGCCCCGGGAGGGCGG + Intronic
927988209 2:27428596-27428618 TGGTCCGGGCGCCGCGAGGGCGG + Exonic
935112121 2:100104170-100104192 GGGGCGGGCCGCCGCGAGGGAGG + Intronic
935112309 2:100104767-100104789 GGGCCGGGCCGCCGCGAGGGAGG - Intronic
935354660 2:102187442-102187464 GGCTCCGTGCGCCGCGAGCGGGG + Intronic
936122851 2:109760981-109761003 GGGGCGGGCCGCCGCGAGGGAGG - Intergenic
936221837 2:110610483-110610505 GGGGCGGGCCGCCGCGAGGGAGG + Intergenic
937950841 2:127387354-127387376 CGGGCTGGGCGCCGGGAGGGGGG - Intronic
938320079 2:130356503-130356525 TGGGGCGGGCGCCGCAGGGGAGG + Intronic
942451081 2:176108164-176108186 GGGCCCGGGGGCCGCGGGGGAGG + Intronic
948202122 2:236136670-236136692 AGGTCCGGGTGTAGCGAGGGTGG - Intergenic
948511076 2:238465733-238465755 TGGTCCTGGCACCGCCAGGGCGG - Intergenic
1171249491 20:23637545-23637567 GGGTCCGGGAGCAGCGCGGGGGG + Intronic
1172117957 20:32583281-32583303 GGGTGAGGGGGCCGCGAGGGAGG - Intronic
1173822694 20:46029405-46029427 TGGTCCGGGGGCGGCGGGGGAGG + Intronic
1176286612 21:5022225-5022247 GGGTGCCGGCGCAGCGAGGGAGG - Intergenic
1179870569 21:44241250-44241272 GGGTGCCGGCGCAGCGAGGGAGG + Intergenic
1181011696 22:20044637-20044659 TGGTCCCGGCACCGTGTGGGAGG + Intronic
1182338842 22:29603501-29603523 TGGTCTGGGCGACCTGAGGGCGG + Intergenic
1183876749 22:40789303-40789325 GGGTCCGGGCACCGCGTGGACGG - Intronic
949559255 3:5187563-5187585 TGGGCCGCGCCCCGCGAGGCCGG + Intergenic
954110254 3:48429503-48429525 TGGCCCGGGCGGCGGGCGGGGGG - Intronic
959121447 3:102237364-102237386 TGATCCTGGCGCAGCGAGGAAGG + Intronic
961359430 3:126357573-126357595 AAGTCCGGGAGCCGCGCGGGCGG - Intergenic
966411773 3:179652900-179652922 TGGGCCGGGCGCGGCGGCGGGGG - Exonic
969394196 4:6909976-6909998 CGGGCCGCGGGCCGCGAGGGAGG + Intronic
973907364 4:55546040-55546062 CGGGCCGGGCGCCGGGAGGGCGG + Intronic
973982096 4:56315422-56315444 AGGCCCCGGCGACGCGAGGGCGG + Exonic
976812508 4:89111645-89111667 TGGTCTGGGCGCCGCGCAGGCGG + Intergenic
990309841 5:54527346-54527368 TGGTCGGGGAGCCGGGGGGGGGG + Intronic
992325168 5:75653268-75653290 TGGTCCTGGCGCCGTGAGGTTGG + Intronic
996900695 5:128538642-128538664 AGGTCCGGGCGCCGAGAGGAGGG + Intronic
998957466 5:147453055-147453077 TGACCCCTGCGCCGCGAGGGTGG - Intronic
1001556566 5:172641249-172641271 TGGGGCGGGAGCCGGGAGGGAGG - Exonic
1002291718 5:178204933-178204955 TGGCACGGGCGCCGCGGCGGGGG + Exonic
1004044529 6:12011974-12011996 CGGGCCGGGCGGCGCGGGGGAGG - Intronic
1006366797 6:33621033-33621055 TAGTCCGGGAACCCCGAGGGCGG + Exonic
1007673406 6:43575649-43575671 AGGTCCAGGGGCCGCGTGGGCGG + Intronic
1015965714 6:138693469-138693491 CAGTGCGGGCGCCGGGAGGGCGG + Intergenic
1016433010 6:144007935-144007957 GGGTCCGGGCTCCGCGGGGCCGG - Intronic
1018818205 6:167351384-167351406 TGGTCCGGGGGCGGGGGGGGGGG + Intronic
1019718861 7:2555762-2555784 TGGGCGGGGCGTCTCGAGGGCGG + Intergenic
1021163024 7:17299027-17299049 TGGGCCTGGCGCAGTGAGGGTGG - Exonic
1021958765 7:25852453-25852475 TGCTCCGGGTTTCGCGAGGGCGG + Intergenic
1022285942 7:28956451-28956473 TGGGGTGGGCTCCGCGAGGGCGG + Exonic
1029746407 7:102517772-102517794 TGGACTGGGCGCCGCAGGGGGGG + Exonic
1032837999 7:135691427-135691449 TGGGGCGGGGGCCGGGAGGGGGG + Intronic
1034451119 7:151137887-151137909 TGGTCCGGGAGCGGGGCGGGGGG - Intronic
1037143112 8:15540689-15540711 TGGGGCGGGAGCCGCGAGGGTGG + Intronic
1042368231 8:67960565-67960587 TGTTCCGGGAGCCACCAGGGAGG + Intronic
1047217414 8:122887812-122887834 TGGTGGGGGCGGCGCGAGGGTGG - Intronic
1049358073 8:142198553-142198575 TGGTCCCAGCGCCACGAGGCCGG + Intergenic
1049405465 8:142450141-142450163 GGGTGGGGGCGCAGCGAGGGTGG + Intronic
1049572424 8:143375502-143375524 TGGTGCGGGCGCCACGGGGTCGG + Intronic
1059268351 9:113056716-113056738 GGGTCCGGCAGCCGCGATGGCGG + Intronic
1060555270 9:124504713-124504735 AGGTGCGGGCTCCGCGCGGGCGG - Intronic
1061055245 9:128219025-128219047 TGGACAGGGCGGCGAGAGGGCGG - Intronic
1061365916 9:130172462-130172484 CGGTCCGGGCGCCGCGGCGCGGG - Intergenic
1062360683 9:136186551-136186573 TGGACCGAGCCCCCCGAGGGGGG + Intergenic