ID: 927988210

View in Genome Browser
Species Human (GRCh38)
Location 2:27428597-27428619
Sequence GGTCCGGGCGCCGCGAGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 289}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988199_927988210 7 Left 927988199 2:27428567-27428589 CCTGCCGGCGGTGCGGCACCGCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 927988210 2:27428597-27428619 GGTCCGGGCGCCGCGAGGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 289
927988196_927988210 18 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988210 2:27428597-27428619 GGTCCGGGCGCCGCGAGGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 289
927988200_927988210 3 Left 927988200 2:27428571-27428593 CCGGCGGTGCGGCACCGCCCATC 0: 1
1: 0
2: 0
3: 7
4: 44
Right 927988210 2:27428597-27428619 GGTCCGGGCGCCGCGAGGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 289
927988192_927988210 30 Left 927988192 2:27428544-27428566 CCCAGAACGTCACCCAATGGAAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 927988210 2:27428597-27428619 GGTCCGGGCGCCGCGAGGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 289
927988197_927988210 17 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988210 2:27428597-27428619 GGTCCGGGCGCCGCGAGGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 289
927988193_927988210 29 Left 927988193 2:27428545-27428567 CCAGAACGTCACCCAATGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 927988210 2:27428597-27428619 GGTCCGGGCGCCGCGAGGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988210 Original CRISPR GGTCCGGGCGCCGCGAGGGC GGG Exonic
900284020 1:1890747-1890769 GGGGCGGGCGCCCCCAGGGCGGG + Intronic
900307789 1:2019504-2019526 GGTCCGCGCGGCGCGGGGTCGGG + Intronic
900495425 1:2973925-2973947 GGTCCGGTCACAGCCAGGGCAGG + Intergenic
900798888 1:4725727-4725749 GGTCAGGGTGTCGGGAGGGCCGG + Intronic
901084783 1:6603630-6603652 GGCCCGGGAGCCCCTAGGGCGGG - Intronic
901489417 1:9589092-9589114 GGCCGGGGCGGCGCGGGGGCGGG - Intronic
901577209 1:10210643-10210665 GGCCAGGGCGCGGCGACGGCCGG - Intergenic
902323599 1:15684385-15684407 GGCCCAGGCGAGGCGAGGGCCGG + Exonic
904045175 1:27604237-27604259 GCTCCGCGCGCGGGGAGGGCGGG + Intronic
905174013 1:36125157-36125179 GGTCCGGGGTCCGCGCCGGCGGG + Exonic
905280508 1:36846184-36846206 GGGCCGGGCGGTGAGAGGGCGGG + Intronic
906204313 1:43979106-43979128 GGTTCGGCCGCCGGCAGGGCGGG + Intronic
906306728 1:44724462-44724484 GCTCCGTGCGCCGGGTGGGCGGG + Intronic
906636948 1:47416279-47416301 GGTCCCGGAGCCGCGCGGGCAGG + Exonic
906919462 1:50048337-50048359 GGTCTGGGCAGCGCGGGGGCAGG - Intronic
910676488 1:89821316-89821338 GGGCCGGGGGCTGCGAGGGAAGG + Intronic
915238367 1:154502131-154502153 GCTCGGGGCGCCGAGCGGGCGGG + Intergenic
915333507 1:155127799-155127821 GCGCCGGGCGGGGCGAGGGCGGG + Exonic
915513654 1:156400674-156400696 GGTGCGGGGGGCGCGGGGGCTGG + Intergenic
915722263 1:157993838-157993860 GGTCCGGACGCCACGAGGCGGGG + Intronic
916051357 1:161038931-161038953 GTTGCAGGCGCCGAGAGGGCGGG - Exonic
916179285 1:162070023-162070045 GGTCCGGCCGCCGCGCGGCCAGG + Exonic
919451189 1:197775105-197775127 GGCCCGGGCGCGTCGGGGGCGGG - Intronic
919841756 1:201614382-201614404 GCTGCGGGCGCCTCAAGGGCAGG + Intergenic
920886859 1:209938083-209938105 GCCCCGAGCGCCGCGAGTGCGGG - Intergenic
924707922 1:246513269-246513291 GGCCAGGGTGCCGGGAGGGCAGG + Intergenic
1062857105 10:784839-784861 GCCCCGGGCGCTGCGGGGGCGGG - Intergenic
1065099919 10:22321928-22321950 GGTCCCGGCGCCGCGGGAGTCGG - Intronic
1065100380 10:22325599-22325621 GGGCGGCGCGCCGCGGGGGCGGG - Intronic
1067497754 10:46774859-46774881 CGTCCGGGCAGGGCGAGGGCAGG + Intergenic
1067596895 10:47565555-47565577 CGTCCGGGCAGGGCGAGGGCAGG - Intergenic
1070895592 10:79981469-79981491 AGGCCGGGCGGCGTGAGGGCTGG + Intronic
1074772438 10:116742640-116742662 GGGCGGGGCGCCGGGCGGGCCGG - Intergenic
1075031866 10:119029531-119029553 GGCGCGGGAGCCGCGCGGGCTGG + Intergenic
1075334165 10:121597174-121597196 GGTCCGTGGTCCGCGAGGGTCGG + Intronic
1075522919 10:123154721-123154743 GGTTTGGGCGCGGCGGGGGCCGG + Intronic
1076372713 10:129965243-129965265 GGTCCGGCGGCTCCGAGGGCCGG - Intergenic
1076554316 10:131311865-131311887 GGGCCGGGGAGCGCGAGGGCGGG - Intergenic
1077194444 11:1272285-1272307 GGCCGGGGCGCCGCGGGTGCCGG - Intergenic
1077231974 11:1461778-1461800 GGTGGGGGCGCCGCTGGGGCAGG + Intronic
1078246184 11:9574419-9574441 GGTCCGGCCGCGGCGAGCGGCGG - Exonic
1079128513 11:17734900-17734922 GGTCCGGGCGCGGCGAGGTGAGG - Exonic
1079238394 11:18705795-18705817 GGTGAGGGCGCCGCGGGGTCCGG - Exonic
1081607267 11:44535269-44535291 GATCTGGGCGCCTCGAGGGCGGG + Intergenic
1081869637 11:46377444-46377466 GGTCCGGGGGCTGCCAGGACTGG - Intronic
1083303743 11:61752515-61752537 GGGCTGGGCGCGGCGCGGGCCGG + Intergenic
1083782280 11:64924796-64924818 GATCCGCGCGCTGCGACGGCCGG + Exonic
1084118765 11:67056876-67056898 GGGCCGGGCGCTGAGCGGGCGGG - Exonic
1084447484 11:69212290-69212312 GGTCCTGGAGCCCCCAGGGCAGG - Intergenic
1084767274 11:71320875-71320897 GCTCCGAGCTCCGTGAGGGCAGG + Intergenic
1088823493 11:113475310-113475332 GGGCCGGGCGCGGGGCGGGCGGG + Exonic
1089374792 11:117986565-117986587 GGAGCGGGCGCGGAGAGGGCAGG - Intronic
1089634040 11:119801007-119801029 GGGCAGGGGGCCGGGAGGGCTGG - Intergenic
1089842105 11:121427324-121427346 GGGCCGGGCGCTGCGGGGCCGGG - Intergenic
1091550261 12:1530897-1530919 GCTCCGGGCGCCGCTCGGCCCGG - Intronic
1091797354 12:3304893-3304915 GGGACTGGCGCAGCGAGGGCAGG + Intergenic
1092365111 12:7871382-7871404 GGCCAGGGTGTCGCGAGGGCTGG - Intronic
1094607272 12:31959534-31959556 GGTCCGGGCGGGGCGGGGGCCGG + Intronic
1096548286 12:52356278-52356300 GGGCTGGGCGCCGGGAGGGACGG - Intergenic
1096738874 12:53677199-53677221 GGCCGGGGCGCCGCGGGGCCCGG - Intronic
1097957499 12:65501212-65501234 GCTCCAGGCGCTGGGAGGGCAGG - Intergenic
1100260521 12:92928877-92928899 GGCCCGGGGGCGGGGAGGGCGGG - Intronic
1100869348 12:98894652-98894674 GAGCCGGGATCCGCGAGGGCTGG + Intronic
1104021181 12:124993592-124993614 GGGCGGGGCGCGGCGTGGGCTGG + Intergenic
1105472177 13:20704044-20704066 GCCGCGGGCGCCCCGAGGGCGGG + Exonic
1106517261 13:30465725-30465747 GATCCGGCCGCCGCGCGGGCTGG + Intronic
1108643659 13:52406206-52406228 AGGGCGGGCGCCGGGAGGGCGGG + Intronic
1113503166 13:110794086-110794108 GGTCAGGGAACCCCGAGGGCTGG - Intergenic
1113654103 13:112057411-112057433 GGTGGGGGAGCCGCGAGGGGCGG - Intergenic
1114516167 14:23301618-23301640 GGTCGGCGCGCGGCGGGGGCGGG + Exonic
1115540968 14:34420980-34421002 TGTCTGGGCGCGGCAAGGGCGGG + Intronic
1116426616 14:44798954-44798976 GGTGGGGGCGGCGGGAGGGCGGG - Intergenic
1117545943 14:56794879-56794901 GCACCGGGCGCGGGGAGGGCAGG + Intergenic
1121050496 14:90816475-90816497 GCCCCGGGCGCCGCGAGGAGCGG + Intronic
1121342848 14:93115578-93115600 GGCCCGCGCGGCGGGAGGGCGGG - Intronic
1121473553 14:94174602-94174624 CGGCCGGACGCCGTGAGGGCAGG - Intronic
1122145134 14:99684363-99684385 GGGCCGGGCGCCGAGGGGGCCGG - Exonic
1122265793 14:100546342-100546364 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265802 14:100546359-100546381 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265811 14:100546376-100546398 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265820 14:100546393-100546415 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265829 14:100546410-100546432 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265838 14:100546427-100546449 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265847 14:100546444-100546466 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265856 14:100546461-100546483 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122924589 14:104893712-104893734 GGGCGGGGCTCCTCGAGGGCGGG + Intronic
1123023170 14:105411623-105411645 GGTCAGGGAGCCTCGAGGGGCGG - Intronic
1123024987 14:105420170-105420192 GAGCCGGGGGCCGCGAGGGCGGG - Intronic
1123174129 14:106401337-106401359 GGTCCGGGACGCGCGGGGGCTGG - Intergenic
1123182338 14:106482271-106482293 GGTCCGGGACGCGCGGGGGCTGG - Intergenic
1202944565 14_KI270726v1_random:14459-14481 GGTCCGGGACGCGCGGGGGCTGG + Intergenic
1124500819 15:30225315-30225337 GGCTCAGGCGGCGCGAGGGCAGG - Intergenic
1124742752 15:32313352-32313374 GGCTCAGGCGGCGCGAGGGCAGG + Intergenic
1126940402 15:53759743-53759765 GGTCCGCGCGCTGCGGGGGCAGG - Intronic
1129162052 15:73752661-73752683 GCTCCGGACGCCGCGGGTGCCGG - Exonic
1129351320 15:74957351-74957373 GGTCCGGGAGCCTCGAGCTCCGG - Exonic
1129540100 15:76341775-76341797 TGTCCGGGAGCTGCGAGGACAGG - Exonic
1132588091 16:714958-714980 GGTCCAAGCGCCTCGAGGGTTGG - Intronic
1132697894 16:1210084-1210106 GGTGCCGGAGCCGCGAGGCCTGG + Exonic
1132757677 16:1493845-1493867 GCTCAGGGAGCCGGGAGGGCCGG + Intronic
1132889572 16:2197004-2197026 GGACCGGGCGCCGAGAGACCCGG + Intergenic
1132895746 16:2228613-2228635 GTTCCGGGGGCCACGTGGGCGGG + Intronic
1134150136 16:11798515-11798537 GGTCTGGGTGCCGGCAGGGCTGG + Intergenic
1135408005 16:22211946-22211968 GGTCTGGCCACCGAGAGGGCTGG + Intronic
1137267973 16:46884353-46884375 GGGCCGGGCGGCGCGGGCGCCGG + Intergenic
1137926602 16:52546987-52547009 GGGCCGGGCGCCGGGGGCGCGGG + Exonic
1140025791 16:71289319-71289341 CTTCCCGGTGCCGCGAGGGCGGG - Intronic
1140223030 16:73057983-73058005 GGGCCGGGAGCGGCGGGGGCGGG + Intronic
1141724219 16:85775676-85775698 CCTCCGGGGGCCGAGAGGGCAGG + Intronic
1141959252 16:87393038-87393060 GTCCCGGGCGCGGCGAGGCCGGG - Intronic
1142120248 16:88383407-88383429 GGGCCGGGCGCCGCGAGCGCTGG - Intergenic
1142254109 16:89005821-89005843 GGTCCGGGTGCCACGAGAGTGGG + Intergenic
1142764105 17:2056171-2056193 GGCCAGGGCGGCGCCAGGGCGGG + Intronic
1143697536 17:8631107-8631129 GGTGCGGGCCCCGCGGCGGCCGG + Intergenic
1143711983 17:8741711-8741733 GGCCTGGGCCCCGGGAGGGCTGG - Intronic
1143747102 17:9002995-9003017 GGGCGAGGAGCCGCGAGGGCCGG + Intergenic
1144269083 17:13600741-13600763 GGTCCGGGCGGCTCCGGGGCCGG - Exonic
1144742590 17:17592177-17592199 AGCCTGGGCGCCGCGGGGGCGGG - Intergenic
1146398401 17:32486421-32486443 GGGCCGCGCGCTGCCAGGGCAGG + Intergenic
1147429548 17:40363047-40363069 GGCCGGGGCGCCGGGAGGGCAGG + Exonic
1147667091 17:42155592-42155614 GTTCCGGACGCCCCGAGGGAAGG + Intergenic
1147918100 17:43900545-43900567 GGTCTGGGGGCCGCCATGGCAGG - Intronic
1148108696 17:45132593-45132615 GGCCGGGGCGGTGCGAGGGCGGG + Exonic
1149651529 17:58279245-58279267 GGTCCGCGCACCGCGTGGCCGGG + Intronic
1150212049 17:63446795-63446817 GGCCCGGGCAGGGCGAGGGCGGG - Intergenic
1151419829 17:73989921-73989943 GGTCCCGGCTTCGCCAGGGCAGG + Intergenic
1151876094 17:76868950-76868972 GGCCCGGACGCGGCGAGAGCTGG + Intronic
1152627205 17:81393285-81393307 GGTCCCGGCCCCGCGGGTGCAGG - Intergenic
1152697690 17:81804897-81804919 GATGCGGGCGCCGAGGGGGCCGG - Intronic
1152728992 17:81960841-81960863 GCGCCGGGGGCAGCGAGGGCAGG - Exonic
1152870692 17:82751720-82751742 GGGCCGGGGGCCGCCAGGGCGGG - Intergenic
1153457327 18:5295581-5295603 GCCCCGGGGGCCGCGCGGGCCGG - Intronic
1154199119 18:12287392-12287414 GGTCTGGGCGCAGGGCGGGCGGG - Intergenic
1154214740 18:12407896-12407918 GCTCCGGGCGCGGCGTGGGCGGG - Exonic
1155928917 18:31685511-31685533 GTTTCGGGCGCGGGGAGGGCGGG - Intronic
1159100209 18:63949620-63949642 GGTCCAGGCGCGGGGAGGGGAGG + Intronic
1159586826 18:70289507-70289529 GGCCGGGGCTCCGCGAGGCCTGG + Intronic
1159947843 18:74457262-74457284 GGCCCGGGCGCGGGCAGGGCTGG - Exonic
1160499327 18:79394493-79394515 GCACCGGGCGCCGGGAGGGGAGG - Intergenic
1160597685 18:79988474-79988496 GGCCCGGGGGCGGCGGGGGCCGG - Exonic
1160613919 18:80109601-80109623 GCCACGGGCGGCGCGAGGGCAGG - Intronic
1160696928 19:489363-489385 GGGCCGCGGGCTGCGAGGGCGGG - Intronic
1160777199 19:861737-861759 GGTCCACGCGCTGCCAGGGCAGG - Exonic
1161212741 19:3076092-3076114 GGCACGGGCGCCGCGTGGGTGGG - Intergenic
1161215678 19:3094215-3094237 GGGCGGGGCGGGGCGAGGGCGGG - Intergenic
1161298514 19:3531855-3531877 GGCCCCAGCTCCGCGAGGGCAGG + Intronic
1161307964 19:3577850-3577872 GGTCCGGACACCGCCAGCGCAGG - Intronic
1161628594 19:5340236-5340258 GGGCCGGGCGCCGCCGGGGCCGG + Intronic
1161672582 19:5622449-5622471 GGTCCGGGAGCCGCGGTGACAGG + Intronic
1162030768 19:7916412-7916434 GGGCCGGGCGCCGCGGGGAACGG - Exonic
1162079414 19:8209459-8209481 CGGCCGGGCGCACCGAGGGCCGG - Exonic
1162776608 19:12983634-12983656 GGCCCGCGCGCAGGGAGGGCGGG - Intergenic
1162932393 19:13963495-13963517 GGTCCGGGCGGCACCAGGGAAGG - Intronic
1162940389 19:14005893-14005915 GGCCCGGCCCCCGCGAGGGGCGG - Intronic
1163117301 19:15196176-15196198 GCTCCGGGCGCCGCGCGCGCCGG + Intronic
1163708630 19:18832390-18832412 GGCCCGGGCGGCGCGGGCGCGGG + Exonic
1164713433 19:30375261-30375283 GGCCCGGGCGCGGGCAGGGCCGG - Intronic
1165129171 19:33621696-33621718 GGTCCGGCGGCCGCGGGGGTGGG - Intergenic
1165739809 19:38198432-38198454 GGTCCAGGCGCCGCAGGGGGCGG - Exonic
1166094536 19:40530693-40530715 GGGCGGGGCGGCGCGGGGGCGGG + Intronic
1166304233 19:41928546-41928568 GGCCGGGCGGCCGCGAGGGCGGG - Intronic
1167437450 19:49487644-49487666 GGTATGGGCTCCGCGCGGGCCGG + Exonic
1167516952 19:49929110-49929132 GGTTGGGGCCGCGCGAGGGCGGG + Exonic
1167637243 19:50662189-50662211 TGTCCGGGGGCAGCGAGAGCAGG + Exonic
1167693745 19:51002266-51002288 GGTCCGGGATCTGGGAGGGCAGG + Intronic
1167716041 19:51143427-51143449 GGTCCAGAGGCCGGGAGGGCAGG + Intronic
1167738723 19:51311783-51311805 GGTCCGGGGCGCGCGAGGCCTGG - Intergenic
1167768700 19:51500666-51500688 GGTCCAGAGGCCGGGAGGGCAGG - Intronic
1167862544 19:52297130-52297152 GGTCCGAGCGGGGCGGGGGCGGG - Intergenic
1168110575 19:54189492-54189514 GGTCAGGGCCCCGGGCGGGCAGG + Exonic
1168337725 19:55605759-55605781 GGCCCGGGTGCAGCGGGGGCGGG + Intronic
1168641440 19:58034229-58034251 GGTCTCGGCGCCGCGTCGGCGGG + Intronic
926268394 2:11345390-11345412 GCACCGGCCGCCGAGAGGGCAGG - Intronic
927156546 2:20224454-20224476 GGCCCGGCCGCCGCGGTGGCCGG + Intronic
927988210 2:27428597-27428619 GGTCCGGGCGCCGCGAGGGCGGG + Exonic
928309157 2:30195340-30195362 GGTCAGGTAGCCTCGAGGGCTGG + Intergenic
934993386 2:98936512-98936534 TGTCGGGGCTCCGGGAGGGCCGG + Intergenic
935112122 2:100104171-100104193 GGGCGGGCCGCCGCGAGGGAGGG + Intronic
935112308 2:100104766-100104788 GGCCGGGCCGCCGCGAGGGAGGG - Intronic
939629739 2:144517104-144517126 GGTCCAGCCGCCGCGCGCGCCGG + Intronic
940351979 2:152701366-152701388 TGTCAGGGCGCGGCAAGGGCAGG - Intronic
942451082 2:176108165-176108187 GGCCCGGGGGCCGCGGGGGAGGG + Intronic
947187084 2:227465045-227465067 GCTCCGGGCACCGCAGGGGCAGG + Intergenic
948202121 2:236136669-236136691 GGTCCGGGTGTAGCGAGGGTGGG - Intergenic
948511075 2:238465732-238465754 GGTCCTGGCACCGCCAGGGCGGG - Intergenic
1168965296 20:1894874-1894896 GGTCGGGCTGCCGGGAGGGCGGG + Intronic
1169914635 20:10673386-10673408 GCCCAGGGCGCCGCGAGGGGAGG + Intronic
1170156613 20:13274667-13274689 GGGCCGGGCGCGGGGGGGGCGGG - Intronic
1172117956 20:32583280-32583302 GGTGAGGGGGCCGCGAGGGAGGG - Intronic
1172666818 20:36605929-36605951 GGCCCGGGCGGCGCGACGGGAGG + Exonic
1173822695 20:46029406-46029428 GGTCCGGGGGCGGCGGGGGAGGG + Intronic
1175428789 20:58888958-58888980 GGCGCGGGGGCCGCGATGGCGGG - Intronic
1175540240 20:59743646-59743668 GGTGCGGGAGTCGCGTGGGCTGG - Intronic
1175858145 20:62133728-62133750 GGTGCGGGAGTCGCGTGGGCTGG + Intronic
1175997154 20:62817014-62817036 GGGGCGGGCGGCGCGCGGGCGGG - Intronic
1176194295 20:63830521-63830543 GGTCCCGGCGCCCTGAGGCCGGG - Intronic
1176286611 21:5022224-5022246 GGTGCCGGCGCAGCGAGGGAGGG - Intergenic
1176380728 21:6111089-6111111 GGGCCGGGCGCCGCGTGCGGCGG + Intergenic
1179742744 21:43427151-43427173 GGGCCGGGCGCCGCGTGCGGCGG - Intergenic
1179794875 21:43776752-43776774 GGTCCCGGCCCCGCGGGAGCAGG + Intergenic
1179870570 21:44241251-44241273 GGTGCCGGCGCAGCGAGGGAGGG + Intergenic
1180559148 22:16601749-16601771 GGGCCCGGCGCGGGGAGGGCGGG - Intergenic
1180650159 22:17370136-17370158 GGAGCAGGCACCGCGAGGGCGGG + Intronic
1180960095 22:19758670-19758692 CGGCCGGGCGCAGGGAGGGCCGG - Intronic
1181082213 22:20423308-20423330 CAGCCGGGCTCCGCGAGGGCAGG - Intergenic
1181404564 22:22673504-22673526 GGTCTGGGAGCCCTGAGGGCTGG - Intergenic
1182338843 22:29603502-29603524 GGTCTGGGCGACCTGAGGGCGGG + Intergenic
1182445555 22:30387400-30387422 GGGCGGGGCGCCGGGAGGGGCGG + Intronic
1183201307 22:36387444-36387466 GGCCTGGGCGAGGCGAGGGCGGG + Intronic
1184276336 22:43411590-43411612 GGACCGGGCCGCGCGCGGGCTGG - Intronic
1185347535 22:50317042-50317064 GGGCGGGGGGCCGCGAGGACAGG + Intronic
949559256 3:5187564-5187586 GGGCCGCGCCCCGCGAGGCCGGG + Intergenic
951982001 3:28576085-28576107 GGCCCAGACGCCGCCAGGGCCGG + Intergenic
953397058 3:42581835-42581857 CGTCCGGGCGAGGTGAGGGCTGG - Exonic
954693915 3:52410319-52410341 GGCCCGGGTGCTGCGAGGGGAGG + Exonic
961013400 3:123449808-123449830 GGCCCGGGCGGCGCGGGGGGCGG - Intergenic
961359429 3:126357572-126357594 AGTCCGGGAGCCGCGCGGGCGGG - Intergenic
961775067 3:129278781-129278803 GGGCCTGGCGCCGGGAGCGCGGG + Intergenic
966787757 3:183636132-183636154 GGGCCGGGCGCCGCCGGGGGAGG + Intronic
967100228 3:186210106-186210128 GGGCCTGGAGCCGGGAGGGCAGG + Intronic
968556552 4:1248846-1248868 GGGGCGGGTGCCGCGCGGGCGGG - Intronic
968578511 4:1378979-1379001 GGTCCAGGCGGCCCCAGGGCAGG + Intronic
968583747 4:1406493-1406515 GGTGCGGGGGCCGCCAGGGATGG - Intergenic
969336890 4:6516264-6516286 GGTCCTGGAGCCCCCAGGGCAGG - Intronic
969394197 4:6909977-6909999 GGGCCGCGGGCCGCGAGGGAGGG + Intronic
969597756 4:8158616-8158638 GCTCGCGGCGCCGCAAGGGCTGG - Intronic
969870030 4:10098840-10098862 GTGCCGGGCCCCGTGAGGGCTGG - Intronic
973907365 4:55546041-55546063 GGGCCGGGCGCCGGGAGGGCGGG + Intronic
973982097 4:56315423-56315445 GGCCCCGGCGACGCGAGGGCGGG + Exonic
975556773 4:75673182-75673204 TGTACGGGCGCCGGGAGGGGAGG - Intronic
977809846 4:101346553-101346575 GGGAAGGGCGCCGCGGGGGCGGG + Intronic
978351503 4:107824971-107824993 GCTCCGTGCGCGCCGAGGGCTGG - Intronic
980541465 4:134201607-134201629 TCTCCGGGCGCCGCGCGGGTCGG - Intronic
981550647 4:145937889-145937911 GGTCGGGGCGCGCGGAGGGCTGG - Intronic
984801738 4:183722771-183722793 GGTGCGGGGGCCGGGCGGGCGGG - Intergenic
985696676 5:1344892-1344914 GGGCTGGGCGCCGGGCGGGCGGG - Exonic
985748225 5:1659844-1659866 GGTCCGGGTGCCGGCAGGGTTGG + Intergenic
995224728 5:109689853-109689875 GGTGCCGGTGCCGCGGGGGCGGG + Exonic
996900696 5:128538643-128538665 GGTCCGGGCGCCGAGAGGAGGGG + Intronic
997235915 5:132271800-132271822 GTTCCGGGGGCCGCCAGGCCCGG - Exonic
997551650 5:134758628-134758650 GGTGCGGGCGCCGGGAAGACTGG + Intergenic
997975438 5:138439182-138439204 GGGCCGGGCGCGGCGCGGGGCGG - Exonic
998228839 5:140346523-140346545 GGTCGGGCGGCCGCGCGGGCGGG - Exonic
1000296293 5:159916286-159916308 GGGGCAGGGGCCGCGAGGGCGGG - Intergenic
1001556515 5:172641067-172641089 GGCGCGGGAGCGGCGAGGGCGGG + Intergenic
1002029368 5:176416542-176416564 GGTGCGGGCGCCGCGGCGGGAGG + Exonic
1002621990 5:180494519-180494541 AGGCCGGGGGCCGAGAGGGCGGG + Intronic
1002720932 5:181261218-181261240 GTGCCGGGGGCCGCGCGGGCCGG + Intergenic
1005928918 6:30466366-30466388 GGGGCGGGAGCCGCGAGGCCCGG + Intergenic
1006472710 6:34237470-34237492 GGGCCGCGCGGCGCGGGGGCGGG + Intronic
1006665100 6:35688305-35688327 GGTCCGGGCGCCGGGACAACCGG - Intronic
1006671268 6:35731388-35731410 GGTGGGGGCGCAGCGGGGGCGGG - Intergenic
1007558211 6:42783558-42783580 GACCAGGGCGCCGCGAGGCCCGG + Intronic
1007673407 6:43575650-43575672 GGTCCAGGGGCCGCGTGGGCGGG + Intronic
1013524069 6:110958574-110958596 GCTACGGGCGCCGAGAGCGCCGG - Exonic
1015625902 6:135181083-135181105 GGCCCGGGAGGCGCGCGGGCAGG - Intergenic
1016433009 6:144007934-144007956 GGTCCGGGCTCCGCGGGGCCGGG - Intronic
1016714041 6:147203885-147203907 GGCTCGGGAGCGGCGAGGGCGGG + Intergenic
1017672519 6:156779630-156779652 GGTCGGGGCGCCCCGGGGGCCGG + Intronic
1019356580 7:583038-583060 GGTCCGGGGGCTGCCAGGGCCGG + Intronic
1019474559 7:1237635-1237657 GAGCCGGGGGCTGCGAGGGCCGG + Intergenic
1019718862 7:2555763-2555785 GGGCGGGGCGTCTCGAGGGCGGG + Intergenic
1020274381 7:6615709-6615731 GGGCCGGGCCGCGCGGGGGCCGG - Exonic
1020657083 7:10940597-10940619 GCGCCGGGCGCCTGGAGGGCAGG + Intergenic
1020796801 7:12686834-12686856 CGCCCGGGCGGCGCGCGGGCAGG + Intronic
1022285943 7:28956452-28956474 GGGGTGGGCTCCGCGAGGGCGGG + Exonic
1024556387 7:50606444-50606466 GGCCCGGGAGCCCCGAGGCCCGG + Intronic
1025098501 7:56116162-56116184 GGGCAGGGCGCAGCAAGGGCCGG - Exonic
1025777337 7:64570480-64570502 GGTCCGGGGCGCGCGAGGCCTGG + Intergenic
1026866627 7:73828077-73828099 GGGCCGGGGGCCGGGGGGGCAGG + Intronic
1029110823 7:98212324-98212346 GGGCCCGGCGCCGTGGGGGCCGG - Exonic
1031629699 7:124032365-124032387 GACCCGGGCGCCGGGAGGGACGG + Exonic
1032119254 7:129144804-129144826 GGGCCGGGAGCGGCGCGGGCCGG - Intergenic
1033406444 7:141074241-141074263 GTTCCGGGTGCGGCGAGGGAAGG + Exonic
1034618138 7:152436180-152436202 GGGCCCGGCGCGGGGAGGGCCGG + Intergenic
1034911672 7:155002987-155003009 GCGCCGGGCGCCGCGGGGGCCGG - Exonic
1035266067 7:157690889-157690911 GGCCGGGGCGCGGCGCGGGCGGG + Intronic
1035341858 7:158167211-158167233 GGTCCGGGACCCGGGAGGGTAGG + Exonic
1035374310 7:158397360-158397382 GGTCCTGCCGCTGGGAGGGCTGG - Intronic
1035682891 8:1501451-1501473 TGTCCGGGCCCCGCCAGAGCGGG - Intronic
1037143113 8:15540690-15540712 GGGGCGGGAGCCGCGAGGGTGGG + Intronic
1037826830 8:22164947-22164969 GGGCCGCGGGCCGCGAGGCCGGG - Exonic
1039886001 8:41654165-41654187 GGGGCGCCCGCCGCGAGGGCGGG + Intronic
1039921395 8:41896593-41896615 GTTCGTGGCGCCCCGAGGGCCGG + Exonic
1040543645 8:48380644-48380666 GGGCCCGGCGCCGTGCGGGCAGG + Intergenic
1041689843 8:60678507-60678529 GGGCCGCGGGCCGCAAGGGCGGG - Intergenic
1043390120 8:79784086-79784108 GGTCCGGGCGCCTGGAGCTCCGG - Intergenic
1044962264 8:97542748-97542770 GGTCCTGGCCCTGGGAGGGCAGG - Intergenic
1045571300 8:103371483-103371505 GCTCCGGGTGTCGCGGGGGCGGG + Intergenic
1047217413 8:122887811-122887833 GGTGGGGGCGGCGCGAGGGTGGG - Intronic
1049189199 8:141277254-141277276 GGTCCGGGTCCGGCGAGGACCGG + Intronic
1049218302 8:141417702-141417724 GTGCGGGGCGCGGCGAGGGCCGG - Intronic
1049361640 8:142214847-142214869 GATCAGGGTGCCGCCAGGGCTGG - Intronic
1049396528 8:142403487-142403509 GGTCCGGGCTCGGCCTGGGCTGG - Intergenic
1049405466 8:142450142-142450164 GGTGGGGGCGCAGCGAGGGTGGG + Intronic
1049478047 8:142806006-142806028 GGACCGGGCGCTGGCAGGGCAGG - Intergenic
1049572425 8:143375503-143375525 GGTGCGGGCGCCACGGGGTCGGG + Intronic
1049726579 8:144149119-144149141 GGTCCCGGCGAGGCGAGGGCTGG + Intronic
1050952835 9:11618751-11618773 GGTCGGGGCAGGGCGAGGGCAGG - Intergenic
1053073733 9:35115916-35115938 GGCCCGGGCGTTGCGGGGGCGGG - Intronic
1055091053 9:72365061-72365083 GGACCGCGCGCCGCGAGGCCTGG + Intronic
1057388354 9:94623528-94623550 GCTCGGGGGGCCGGGAGGGCTGG + Intronic
1057504181 9:95618895-95618917 GGTCTGGGCACAGCCAGGGCTGG + Intergenic
1057781911 9:98056967-98056989 GATTCGGGCGCCGGGAGGGGCGG + Intronic
1060358277 9:122931266-122931288 GGGCGGGGCGCAGCGTGGGCCGG + Intronic
1060555269 9:124504712-124504734 GGTGCGGGCTCCGCGCGGGCGGG - Intronic
1060796242 9:126514586-126514608 GGTCCGGACGCCGCAGGGGGTGG - Intergenic
1061055244 9:128219024-128219046 GGACAGGGCGGCGAGAGGGCGGG - Intronic
1061365915 9:130172461-130172483 GGTCCGGGCGCCGCGGCGCGGGG - Intergenic
1062305922 9:135907208-135907230 GGGCCCGGCGCGGCGAGGGGCGG - Exonic
1062354840 9:136157003-136157025 GGTCTGGGGGCCACCAGGGCTGG + Intergenic
1062428587 9:136517112-136517134 GGTGCGGACGGCCCGAGGGCAGG + Intronic
1062461922 9:136665853-136665875 GGTCCGGTCGCCGCCCGGGCTGG + Intronic
1203771970 EBV:54085-54107 GGTCCGGGCGCTGGAAGAGCAGG - Intergenic
1187507194 X:19887413-19887435 GGTCCGGACGCGGCGGCGGCTGG + Exonic
1198254724 X:134914941-134914963 GGGCCGGGCGCCGCGGGCGGCGG + Intronic
1200062846 X:153491311-153491333 GGTGGGGGCGCCCAGAGGGCAGG - Intronic
1200249824 X:154546964-154546986 GGGCGGGGCGGGGCGAGGGCAGG + Exonic
1200794214 Y:7325866-7325888 GCTCAGGGCCCCGCCAGGGCAGG - Intergenic