ID: 927988211

View in Genome Browser
Species Human (GRCh38)
Location 2:27428598-27428620
Sequence GTCCGGGCGCCGCGAGGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988196_927988211 19 Left 927988196 2:27428556-27428578 CCCAATGGAAACCTGCCGGCGGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 927988211 2:27428598-27428620 GTCCGGGCGCCGCGAGGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 226
927988204_927988211 -10 Left 927988204 2:27428585-27428607 CCGCCCATCGTTGGTCCGGGCGC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 927988211 2:27428598-27428620 GTCCGGGCGCCGCGAGGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 226
927988197_927988211 18 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988211 2:27428598-27428620 GTCCGGGCGCCGCGAGGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 226
927988199_927988211 8 Left 927988199 2:27428567-27428589 CCTGCCGGCGGTGCGGCACCGCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 927988211 2:27428598-27428620 GTCCGGGCGCCGCGAGGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 226
927988200_927988211 4 Left 927988200 2:27428571-27428593 CCGGCGGTGCGGCACCGCCCATC 0: 1
1: 0
2: 0
3: 7
4: 44
Right 927988211 2:27428598-27428620 GTCCGGGCGCCGCGAGGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 226
927988193_927988211 30 Left 927988193 2:27428545-27428567 CCAGAACGTCACCCAATGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 927988211 2:27428598-27428620 GTCCGGGCGCCGCGAGGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988211 Original CRISPR GTCCGGGCGCCGCGAGGGCG GGG Exonic
900166751 1:1247013-1247035 GCCCGGGCGCCCCGACGGCCAGG + Intergenic
900307790 1:2019505-2019527 GTCCGCGCGGCGCGGGGTCGGGG + Intronic
900671296 1:3856801-3856823 GCGCGGGCGCCGCGGGGGCGCGG - Intronic
901628943 1:10638930-10638952 CCGCGGGCGCCGCTAGGGCGAGG + Exonic
901797941 1:11691493-11691515 GCGCCGCCGCCGCGAGGGCGCGG - Exonic
902214116 1:14924032-14924054 GTCTGGGCGCCGCGGCGGGGCGG + Intronic
902585663 1:17437781-17437803 GCCCGGGCGCCGCGGGGAGGGGG - Intronic
903349827 1:22710936-22710958 GTCCGGGCCCCGCGGCGCCGCGG + Intronic
903883721 1:26529631-26529653 CTCGGGGCGCGGCGGGGGCGGGG + Intergenic
904045176 1:27604238-27604260 CTCCGCGCGCGGGGAGGGCGGGG + Intronic
904181412 1:28669022-28669044 GTCGCGGCGCCGCGGGGGGGTGG + Intronic
904253020 1:29237910-29237932 GTCCGGGCGCGGGCAGGGCCTGG + Intronic
904831060 1:33307051-33307073 ATTCGGCCGCCGCGATGGCGTGG - Exonic
905174014 1:36125158-36125180 GTCCGGGGTCCGCGCCGGCGGGG + Exonic
905280509 1:36846185-36846207 GGCCGGGCGGTGAGAGGGCGGGG + Intronic
905390851 1:37634595-37634617 GCCCGGGAGGGGCGAGGGCGCGG + Exonic
906306729 1:44724463-44724485 CTCCGTGCGCCGGGTGGGCGGGG + Intronic
906481633 1:46203304-46203326 GCCCCCGCGCCGCGCGGGCGGGG + Intronic
906636949 1:47416280-47416302 GTCCCGGAGCCGCGCGGGCAGGG + Exonic
907118727 1:51990609-51990631 GACCTGGCGTCGGGAGGGCGCGG + Exonic
907490470 1:54806013-54806035 GTGGGGGCGCCACGTGGGCGAGG + Intergenic
908703874 1:66930195-66930217 GCCGGGGCGCCGCGAGGGGGCGG + Intronic
914703015 1:150150601-150150623 GTCCCCGCGCGGCGAGGACGGGG + Intronic
915333508 1:155127800-155127822 CGCCGGGCGGGGCGAGGGCGGGG + Exonic
915722264 1:157993839-157993861 GTCCGGACGCCACGAGGCGGGGG + Intronic
916179286 1:162070024-162070046 GTCCGGCCGCCGCGCGGCCAGGG + Exonic
918348998 1:183635187-183635209 TCCCCAGCGCCGCGAGGGCGCGG + Intronic
918349100 1:183635536-183635558 GGCCGGGCCCGACGAGGGCGAGG - Exonic
919101754 1:193105154-193105176 GCCCCGGCGCCGGGTGGGCGAGG - Intronic
919712211 1:200739363-200739385 GTGCGGGCATCGCGATGGCGGGG + Intergenic
919916841 1:202144317-202144339 GGCCGGGCGCCGGGCGGGGGAGG - Intronic
920394173 1:205631840-205631862 GTGCGGGGGCGGGGAGGGCGGGG - Exonic
920924482 1:210328881-210328903 GTCCGGGCGCGGAGGGCGCGCGG + Intronic
922460266 1:225810218-225810240 GTTCGGGCTCCGCGCGGGCTCGG + Intronic
923141495 1:231163817-231163839 GCCCGGGAGGCGCGGGGGCGGGG + Exonic
1064022789 10:11823298-11823320 GTTCGGGCGGCGCGAGCGCGCGG + Intergenic
1065100379 10:22325598-22325620 GGCGGCGCGCCGCGGGGGCGGGG - Intronic
1067028701 10:42866119-42866141 GCCCGGCCGCCGCGAGCTCGCGG + Intergenic
1069881650 10:71597195-71597217 GTCCTGGGGCCGGGAGGGTGGGG + Intronic
1070877268 10:79826032-79826054 GTCCGGGGGCAGCGTGGGGGAGG - Intergenic
1070895593 10:79981470-79981492 GGCCGGGCGGCGTGAGGGCTGGG + Intronic
1071643765 10:87342076-87342098 GTCCGGGGGCAGCGTGGGGGAGG - Intergenic
1071997677 10:91163322-91163344 GGCCGGGCGCCGGGCGGGCAAGG + Intronic
1076554277 10:131311789-131311811 GTCCGGGGGCGGCGGCGGCGCGG - Intergenic
1076554315 10:131311864-131311886 GGCCGGGGAGCGCGAGGGCGGGG - Intergenic
1077049052 11:558561-558583 GTCCGGGCGAGGACAGGGCGGGG + Intronic
1077870827 11:6260052-6260074 GTCCCGGCTCCGCGAATGCGAGG - Exonic
1079076744 11:17389209-17389231 GCCCGGGCGGCGGGAGGGGGCGG - Intronic
1079459960 11:20670233-20670255 GGCCGGGGCCCGGGAGGGCGCGG + Intronic
1081607268 11:44535270-44535292 ATCTGGGCGCCTCGAGGGCGGGG + Intergenic
1090616751 11:128522223-128522245 GAGCGGGCGCGGCGCGGGCGAGG - Intronic
1091207930 11:133833605-133833627 ATCAGGGCGCCGCGCGGCCGCGG - Intergenic
1094607273 12:31959535-31959557 GTCCGGGCGGGGCGGGGGCCGGG + Intronic
1096134472 12:49188362-49188384 GTCAGGGCGGCGCAGGGGCGGGG - Intronic
1096738864 12:53677182-53677204 GCCCGGGAGCCGGGAGGGGGCGG - Intronic
1096994312 12:55829507-55829529 GGCCGGGCGGCTCGAGGGGGAGG - Exonic
1101253423 12:102956442-102956464 GTGCTGGCGCCGAGAGGGAGGGG - Intronic
1101910489 12:108857400-108857422 GGCCGGGCGCGGCGAGCCCGGGG + Intronic
1106517262 13:30465726-30465748 ATCCGGCCGCCGCGCGGGCTGGG + Intronic
1108643660 13:52406207-52406229 GGGCGGGCGCCGGGAGGGCGGGG + Intronic
1111333605 13:86792545-86792567 GACCGGGCGCCGCGTGGAGGAGG - Intergenic
1113082791 13:106535416-106535438 GCGCGGGCGCCGCGTCGGCGCGG + Intergenic
1113932274 13:113974691-113974713 GTCCTGGCGCCGTGTGGGTGGGG - Intergenic
1114516168 14:23301619-23301641 GTCGGCGCGCGGCGGGGGCGGGG + Exonic
1116426615 14:44798953-44798975 GTGGGGGCGGCGGGAGGGCGGGG - Intergenic
1122145133 14:99684362-99684384 GGCCGGGCGCCGAGGGGGCCGGG - Exonic
1122470735 14:101964440-101964462 GTCACGGCGCCGCGCGTGCGCGG - Intergenic
1122904554 14:104795771-104795793 CTCCGGGCGCGGGGCGGGCGCGG - Intergenic
1122924590 14:104893713-104893735 GGCGGGGCTCCTCGAGGGCGGGG + Intronic
1122960897 14:105093300-105093322 GTCCGGGCGGCGCGCAGGCGCGG - Intergenic
1123036713 14:105474687-105474709 CTGGGGGCGCCGCGGGGGCGGGG - Intronic
1123464620 15:20506129-20506151 GTCCGCGCGCCGGCGGGGCGGGG - Intergenic
1123653494 15:22494912-22494934 GTCCGCGCGCCGGCGGGGCGAGG + Intergenic
1124696890 15:31870812-31870834 GTCCGCGCGGGGCGGGGGCGGGG - Intergenic
1126150832 15:45522568-45522590 GCCGGGGCTCCGCGAGGGGGCGG + Intronic
1129540099 15:76341774-76341796 GTCCGGGAGCTGCGAGGACAGGG - Exonic
1130011072 15:80153156-80153178 GTCCGGGCGCGGGGAGGGAGTGG + Intronic
1131829193 15:96343653-96343675 GTCCCGGGGGAGCGAGGGCGCGG + Intergenic
1131992394 15:98104503-98104525 GGCCGGGCGCTCCGAGTGCGAGG + Intergenic
1132398206 15:101489464-101489486 GACGGGGCGCGGCGGGGGCGCGG + Exonic
1132642022 16:982349-982371 GTGCCGGCGCCCCGGGGGCGGGG + Intronic
1132844283 16:1992783-1992805 GTGCGGGGCCCGGGAGGGCGGGG + Intronic
1132865600 16:2091354-2091376 GGCGGGGCCCCGCGAGGGGGCGG + Intronic
1133097654 16:3458221-3458243 GGCGGGGCGCCGAGGGGGCGGGG + Intronic
1133212924 16:4273123-4273145 CCCCGGGCGGCGCGAGGCCGGGG + Intergenic
1137426333 16:48384709-48384731 CTCCGGGCGCCGCGGGGAGGAGG + Intronic
1137926603 16:52546988-52547010 GGCCGGGCGCCGGGGGCGCGGGG + Exonic
1138273835 16:55716603-55716625 GTCCTGGCGGGGCGGGGGCGGGG + Intergenic
1139451220 16:67029302-67029324 GTCCGGGCGCCGCGGGTGGGCGG + Exonic
1139465133 16:67150358-67150380 GCGAGCGCGCCGCGAGGGCGAGG - Exonic
1140223031 16:73057984-73058006 GGCCGGGAGCGGCGGGGGCGGGG + Intronic
1141553179 16:84819802-84819824 GCGCGGGCGCCGGGTGGGCGAGG - Intergenic
1141959251 16:87393037-87393059 TCCCGGGCGCGGCGAGGCCGGGG - Intronic
1142120247 16:88383406-88383428 GGCCGGGCGCCGCGAGCGCTGGG - Intergenic
1142683155 17:1562130-1562152 GGCCGGGGACAGCGAGGGCGAGG - Intronic
1143541868 17:7573771-7573793 ATCCGGGCAACGCGAGGGGGGGG + Intronic
1145049539 17:19648664-19648686 GGGCGGGGGCCGCGTGGGCGAGG + Intronic
1147159553 17:38562278-38562300 GTTGAGGCGCCGCGTGGGCGAGG + Exonic
1147429549 17:40363048-40363070 GCCGGGGCGCCGGGAGGGCAGGG + Exonic
1148108697 17:45132594-45132616 GCCGGGGCGGTGCGAGGGCGGGG + Exonic
1149865783 17:60150225-60150247 CGCCGGGGGCCGCGAGGGTGCGG + Intronic
1150212048 17:63446794-63446816 GCCCGGGCAGGGCGAGGGCGGGG - Intergenic
1151595853 17:75077700-75077722 CTCCGGGCGCCGCTTGAGCGTGG - Intergenic
1151836387 17:76585482-76585504 GTCCGGGCAGCGCGAGGTCAAGG + Intronic
1152870691 17:82751719-82751741 GGCCGGGGGCCGCCAGGGCGGGG - Intergenic
1154214739 18:12407895-12407917 CTCCGGGCGCGGCGTGGGCGGGG - Exonic
1154501328 18:14999319-14999341 GCCCGGGCACCGTGAGGCCGTGG + Intergenic
1155218401 18:23662845-23662867 GGCCGGGCGGCGGGAGCGCGCGG - Exonic
1155928916 18:31685510-31685532 TTTCGGGCGCGGGGAGGGCGGGG - Intronic
1157338168 18:46756515-46756537 TACCGGGCGCCGCGGGCGCGGGG + Exonic
1160436709 18:78857434-78857456 GCCCGGGCTACGCGAGCGCGGGG - Intergenic
1160453069 18:78978912-78978934 GTGCGCGCGGGGCGAGGGCGAGG + Intergenic
1160957178 19:1699153-1699175 GGGCGGGCGCCGCGGGGGCCTGG + Intergenic
1160967674 19:1753767-1753789 GCCCGGGCGCCACCAGGCCGCGG - Exonic
1161212740 19:3076091-3076113 GCACGGGCGCCGCGTGGGTGGGG - Intergenic
1161215677 19:3094214-3094236 GGCGGGGCGGGGCGAGGGCGGGG - Intergenic
1161309397 19:3585662-3585684 GGCCGGGGGCTCCGAGGGCGCGG - Exonic
1161471266 19:4457716-4457738 GGCGGGGGGCCGCGGGGGCGGGG + Exonic
1162396572 19:10420812-10420834 GCCCGGGCCCCGGGAGGGCCAGG + Exonic
1162776607 19:12983633-12983655 GCCCGCGCGCAGGGAGGGCGGGG - Intergenic
1162832973 19:13298656-13298678 GGCCCGGGGCGGCGAGGGCGAGG - Exonic
1163138715 19:15332152-15332174 ATCCGCGCGGCGCGGGGGCGGGG - Intronic
1165129241 19:33621896-33621918 GGCGGGGCGCCGGGCGGGCGCGG + Intergenic
1167056034 19:47112199-47112221 GGGCGAGCGCCGCGAGGGGGGGG + Intronic
1167306791 19:48714354-48714376 GTCAGGGCTCGGTGAGGGCGGGG - Exonic
1167516953 19:49929111-49929133 GTTGGGGCCGCGCGAGGGCGGGG + Exonic
1167862543 19:52297129-52297151 GTCCGAGCGGGGCGGGGGCGGGG - Intergenic
1168307221 19:55442326-55442348 TGCCGGGGGCCGCGGGGGCGAGG - Exonic
1168337726 19:55605760-55605782 GCCCGGGTGCAGCGGGGGCGGGG + Intronic
1168536073 19:57172015-57172037 GGGCGGGGGCCGCGAGGGGGCGG + Intergenic
927988211 2:27428598-27428620 GTCCGGGCGCCGCGAGGGCGGGG + Exonic
928094145 2:28393655-28393677 GCGCGGCCGCGGCGAGGGCGGGG + Exonic
932331674 2:70901449-70901471 GCCCAGGCGCCGCGAGGAAGTGG - Intronic
934993387 2:98936513-98936535 GTCGGGGCTCCGGGAGGGCCGGG + Intergenic
935112123 2:100104172-100104194 GGCGGGCCGCCGCGAGGGAGGGG + Intronic
935112307 2:100104765-100104787 GCCGGGCCGCCGCGAGGGAGGGG - Intronic
935692537 2:105744665-105744687 GTACGGGCGCCGGGATAGCGCGG - Intergenic
937340697 2:121088797-121088819 GTCGGGGGGCGGGGAGGGCGGGG - Intergenic
938018272 2:127885644-127885666 GTCCGGGGGCAGCGGGGGGGAGG - Intronic
938500498 2:131829488-131829510 GCCCGGGCACCGTGAGGCCGTGG + Intergenic
942451083 2:176108166-176108188 GCCCGGGGGCCGCGGGGGAGGGG + Intronic
947353626 2:229271296-229271318 GCCCGGGCCCGGCGAGCGCGCGG + Intergenic
948202120 2:236136668-236136690 GTCCGGGTGTAGCGAGGGTGGGG - Intergenic
948511074 2:238465731-238465753 GTCCTGGCACCGCCAGGGCGGGG - Intergenic
1168965297 20:1894875-1894897 GTCGGGCTGCCGGGAGGGCGGGG + Intronic
1170156612 20:13274666-13274688 GGCCGGGCGCGGGGGGGGCGGGG - Intronic
1171567339 20:26208118-26208140 GGCCGGGGACCGCGAGGGCAAGG + Intergenic
1172284629 20:33732107-33732129 GGCCGGGCGCTGCGAGGGCGCGG - Intronic
1173734155 20:45347949-45347971 CTCTGGGCGCCCCGAGAGCGAGG + Intronic
1173822696 20:46029407-46029429 GTCCGGGGGCGGCGGGGGAGGGG + Intronic
1175428788 20:58888957-58888979 GCGCGGGGGCCGCGATGGCGGGG - Intronic
1175926560 20:62474267-62474289 GCCCGGGCGCCGAGTGGGGGTGG + Intronic
1176194294 20:63830520-63830542 GTCCCGGCGCCCTGAGGCCGGGG - Intronic
1176281624 20:64316744-64316766 GGCGGGGCGCGGCGGGGGCGCGG + Intergenic
1176547507 21:8208162-8208184 GGCCGGGGACCGCGAGGGCAAGG - Intergenic
1176547875 21:8209220-8209242 GTCGGGGCGCCGCGGGGCGGCGG + Intergenic
1176555416 21:8252371-8252393 GGCCGGGGACCGCGAGGGCAAGG - Intergenic
1176566458 21:8391209-8391231 GGCCGGGGACCGCGAGGGCAAGG - Intergenic
1176574334 21:8435396-8435418 GGCCGGGGACCGCGAGGGCAAGG - Intergenic
1180650160 22:17370137-17370159 GAGCAGGCACCGCGAGGGCGGGG + Intronic
1180960094 22:19758669-19758691 GGCCGGGCGCAGGGAGGGCCGGG - Intronic
1181082212 22:20423307-20423329 AGCCGGGCTCCGCGAGGGCAGGG - Intergenic
1181979616 22:26756869-26756891 GTCTGGGCGCCGCGGCCGCGCGG - Intergenic
1182338844 22:29603503-29603525 GTCTGGGCGACCTGAGGGCGGGG + Intergenic
1182638663 22:31749868-31749890 TTCCGCGCCCCGAGAGGGCGGGG + Intronic
1183201308 22:36387445-36387467 GCCTGGGCGAGGCGAGGGCGGGG + Intronic
1185055326 22:48576044-48576066 GGCCGGGCGGCGCGGGGGGGGGG - Intronic
1203252380 22_KI270733v1_random:124447-124469 GGCCGGGGACCGCGAGGGCAAGG - Intergenic
1203260437 22_KI270733v1_random:169533-169555 GGCCGGGGACCGCGAGGGCAAGG - Intergenic
950530228 3:13548912-13548934 GGCCGGGCGCAGGGAGGGTGCGG + Intergenic
956659336 3:71583081-71583103 GTCCGGTGGCCGCCCGGGCGCGG - Intronic
963882694 3:150546282-150546304 GCCTGGGCGCCGCAAGCGCGAGG + Exonic
967694422 3:192514903-192514925 GCCCGGGCGCCGGCAGGGGGCGG + Intronic
967837209 3:193974712-193974734 GTCCGGGCGTCGGGGGAGCGGGG + Intergenic
968230398 3:197002256-197002278 GACCGGGAGCCGCGTGGGCGCGG - Exonic
968556551 4:1248845-1248867 GGGCGGGTGCCGCGCGGGCGGGG - Intronic
968908004 4:3463430-3463452 GTCGGGGCGCGTCGGGGGCGCGG + Intronic
969330826 4:6472653-6472675 GAGCGGGCGGCGCGAGGGAGGGG - Intronic
970397203 4:15681300-15681322 GTCCTGGCCCCGCCAGGTCGGGG + Intronic
973907366 4:55546042-55546064 GGCCGGGCGCCGGGAGGGCGGGG + Intronic
974036383 4:56821732-56821754 GACGGGGCGCGGGGAGGGCGGGG + Exonic
975612116 4:76213655-76213677 AACCGTGCGCCGGGAGGGCGTGG - Exonic
977809847 4:101346554-101346576 GGAAGGGCGCCGCGGGGGCGGGG + Intronic
980541464 4:134201606-134201628 CTCCGGGCGCCGCGCGGGTCGGG - Intronic
985696675 5:1344891-1344913 GGCTGGGCGCCGGGCGGGCGGGG - Exonic
986330616 5:6713913-6713935 CTCGGGGCGCGGCGGGGGCGGGG + Intergenic
986993264 5:13578593-13578615 GGCCGGCCGCTCCGAGGGCGGGG - Intergenic
987050568 5:14144118-14144140 GGGCGGGCGCAGGGAGGGCGAGG - Intronic
995759160 5:115544978-115545000 GGCGGGGCGCTGCGAGGGGGCGG + Intergenic
998192858 5:140042246-140042268 GTCCGGGCGCTGGGGGGGTGGGG - Intronic
998328568 5:141303936-141303958 GTCCAGCCGCAGCGAGCGCGGGG + Intergenic
998627835 5:143865544-143865566 GTCTGGGAGCCACGAGGGAGAGG + Intergenic
999169483 5:149581430-149581452 GTGCGTGCGCCGCGAGGGGGTGG - Intronic
1000302919 5:159972194-159972216 GCCCGGGCTCGGCGAGGCCGAGG - Exonic
1002524143 5:179806354-179806376 GTCCTCGCGCCGCCCGGGCGGGG + Intronic
1007383292 6:41504141-41504163 GCCCGGGCGCCCCGGGGGTGAGG - Intergenic
1007390187 6:41546352-41546374 GAGCGGGCGGCGCGCGGGCGGGG - Intergenic
1008545175 6:52577269-52577291 GGCCGGGCGCGGCGCTGGCGCGG - Intergenic
1012475750 6:99613640-99613662 GTGCGGGCGCCCCGGGAGCGGGG + Exonic
1013117540 6:107114680-107114702 CGCCGGGCGCCGCGATGGAGCGG - Intronic
1015149339 6:130020215-130020237 GTCCTCGCGCCGCGGCGGCGGGG + Intronic
1019343005 7:517353-517375 CTCCGCGCGCGGGGAGGGCGCGG - Intronic
1019356581 7:583039-583061 GTCCGGGGGCTGCCAGGGCCGGG + Intronic
1019676290 7:2314482-2314504 GTGTGGGCGGGGCGAGGGCGCGG - Intronic
1019718863 7:2555764-2555786 GGCGGGGCGTCTCGAGGGCGGGG + Intergenic
1019989542 7:4682222-4682244 GTCGGGGCGCTGGGCGGGCGCGG - Intergenic
1020066174 7:5190200-5190222 GGCCGTGCGTCGCGGGGGCGGGG + Exonic
1020796802 7:12686835-12686857 GCCCGGGCGGCGCGCGGGCAGGG + Intronic
1021814365 7:24432988-24433010 GGCACGGCGCCGCGAGGGGGCGG + Intergenic
1023638851 7:42238111-42238133 TTCGGCGCGCCGGGAGGGCGCGG - Intergenic
1023773745 7:43583517-43583539 GTGCCGGCGCCGCGGCGGCGAGG + Intronic
1023937292 7:44748947-44748969 GGCCGGGGGCCGCCACGGCGAGG + Exonic
1026330496 7:69348080-69348102 GGCCGGGCGCAGTGGGGGCGCGG + Intergenic
1026471113 7:70694621-70694643 GGCCGGCCGGCGGGAGGGCGAGG - Intronic
1032074524 7:128830227-128830249 GCCCGGGCGGCGCGGGGGAGGGG + Intergenic
1032525630 7:132576894-132576916 GCCCGGGCGCGGCGAGTGCGCGG + Exonic
1034911671 7:155002986-155003008 CGCCGGGCGCCGCGGGGGCCGGG - Exonic
1035682890 8:1501450-1501472 GTCCGGGCCCCGCCAGAGCGGGG - Intronic
1037482019 8:19313965-19313987 CCCCGGGCGCCGCGAAGGGGTGG - Intronic
1037820090 8:22131182-22131204 GCCCGGGTGCCGCGGGGGGGAGG - Exonic
1037826829 8:22164946-22164968 GGCCGCGGGCCGCGAGGCCGGGG - Exonic
1037833142 8:22200935-22200957 GTCCGGGCGCATCCAGGGCACGG - Intronic
1039886002 8:41654166-41654188 GGGCGCCCGCCGCGAGGGCGGGG + Intronic
1040065443 8:43140803-43140825 GGCCGGGCCCCGCGGAGGCGGGG + Intronic
1041355377 8:56993902-56993924 GACGGGGCGGGGCGAGGGCGAGG + Intergenic
1049802973 8:144526810-144526832 GGCCGGGCTCAGGGAGGGCGTGG + Exonic
1053003282 9:34589554-34589576 GCCCGGGTGGCCCGAGGGCGCGG - Exonic
1053073732 9:35115915-35115937 GCCCGGGCGTTGCGGGGGCGGGG - Intronic
1055091054 9:72365062-72365084 GACCGCGCGCCGCGAGGCCTGGG + Intronic
1055611936 9:78032117-78032139 GCCCGGGAGCCGCGCGGGCGAGG - Intergenic
1058508835 9:105694510-105694532 GCCCTGGCGCCGAGGGGGCGGGG - Intergenic
1060770239 9:126327021-126327043 GCCCGGGCGCCGCGGAGGCTCGG + Intronic
1061680590 9:132240965-132240987 CTGCGAGTGCCGCGAGGGCGCGG + Exonic
1061725559 9:132580408-132580430 GTCGGGGAGGCGGGAGGGCGGGG - Intergenic
1062461923 9:136665854-136665876 GTCCGGTCGCCGCCCGGGCTGGG + Intronic
1062499198 9:136845080-136845102 GCCCGGGCACCGTGAGGCCGTGG - Exonic
1062574528 9:137200153-137200175 GCCCGGGCCCCGCGGTGGCGGGG - Exonic
1203468785 Un_GL000220v1:107598-107620 GGCCGGGGACCGCGAGGGCAAGG - Intergenic
1203476606 Un_GL000220v1:151570-151592 GGCCGGGGACCGCGAGGGCAAGG - Intergenic
1187950446 X:24465433-24465455 GTCTGTGCGCCGCCCGGGCGAGG + Intronic
1189002906 X:36964036-36964058 GTGGGGGCGCGGAGAGGGCGCGG + Intergenic
1192033834 X:67543840-67543862 GTGCTGGCGCAGCGTGGGCGAGG - Intergenic
1192425066 X:71068085-71068107 GACCGGGCGGCGCGAGCGGGAGG - Intronic
1200217534 X:154374680-154374702 GGCCGGGCGCGGGGCGGGCGCGG - Intergenic
1200284285 X:154805497-154805519 GGCGGTGCGCCGGGAGGGCGCGG + Exonic
1200402675 X:156028753-156028775 GCCCCGGCGCCACGAGGGGGCGG + Intergenic