ID: 927988214

View in Genome Browser
Species Human (GRCh38)
Location 2:27428610-27428632
Sequence CGAGGGCGGGGCCCGCAGTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927988197_927988214 30 Left 927988197 2:27428557-27428579 CCAATGGAAACCTGCCGGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 35
Right 927988214 2:27428610-27428632 CGAGGGCGGGGCCCGCAGTTCGG 0: 1
1: 0
2: 1
3: 10
4: 96
927988200_927988214 16 Left 927988200 2:27428571-27428593 CCGGCGGTGCGGCACCGCCCATC 0: 1
1: 0
2: 0
3: 7
4: 44
Right 927988214 2:27428610-27428632 CGAGGGCGGGGCCCGCAGTTCGG 0: 1
1: 0
2: 1
3: 10
4: 96
927988206_927988214 -2 Left 927988206 2:27428589-27428611 CCATCGTTGGTCCGGGCGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 24
Right 927988214 2:27428610-27428632 CGAGGGCGGGGCCCGCAGTTCGG 0: 1
1: 0
2: 1
3: 10
4: 96
927988204_927988214 2 Left 927988204 2:27428585-27428607 CCGCCCATCGTTGGTCCGGGCGC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 927988214 2:27428610-27428632 CGAGGGCGGGGCCCGCAGTTCGG 0: 1
1: 0
2: 1
3: 10
4: 96
927988199_927988214 20 Left 927988199 2:27428567-27428589 CCTGCCGGCGGTGCGGCACCGCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 927988214 2:27428610-27428632 CGAGGGCGGGGCCCGCAGTTCGG 0: 1
1: 0
2: 1
3: 10
4: 96
927988205_927988214 -1 Left 927988205 2:27428588-27428610 CCCATCGTTGGTCCGGGCGCCGC 0: 1
1: 0
2: 0
3: 1
4: 10
Right 927988214 2:27428610-27428632 CGAGGGCGGGGCCCGCAGTTCGG 0: 1
1: 0
2: 1
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927988214 Original CRISPR CGAGGGCGGGGCCCGCAGTT CGG Exonic
900093298 1:929892-929914 CGAGAGACGGGGCCGCAGTTGGG - Intronic
911712375 1:101088871-101088893 TGAGGGCTGGGCACACAGTTTGG + Intergenic
922474769 1:225899283-225899305 CCAGGGCTGGGCCCTCAGTGGGG + Intronic
924816588 1:247447349-247447371 TGAGGGTGGGGCCCTCAGTATGG - Intronic
1063661178 10:8035967-8035989 CGGGCGCGTGCCCCGCAGTTGGG - Intergenic
1067463272 10:46474129-46474151 GGAGGGCAGGGCCAGCTGTTTGG - Intergenic
1067623922 10:47910509-47910531 GGAGGGCAGGGCCAGCTGTTTGG + Intergenic
1068022796 10:51605339-51605361 CGAGGGTGGGGCCCTCATTAGGG + Intronic
1069738355 10:70672371-70672393 CGGGGGCGGGGCGCGCGGCTGGG - Intergenic
1070025295 10:72626223-72626245 CTAGGGCGGGGCCCGAGGCTGGG - Intergenic
1076137862 10:128057248-128057270 GGGGGGCGGGGCGTGCAGTTGGG + Intronic
1076876228 10:133217351-133217373 AGAGGGCTGGGGCCGCAGTCGGG + Intronic
1077948259 11:6926391-6926413 CGTGGGCGGGGCCTGCAGAAAGG + Intronic
1083900260 11:65640191-65640213 AGAGGGCTGGGCCCACAGTTGGG + Exonic
1084145220 11:67261623-67261645 CGAGGGCGGGGGCGGGGGTTCGG + Intergenic
1084476934 11:69394510-69394532 CGTGGGCGGGCCCTGCAGTGTGG - Intergenic
1085123618 11:73982879-73982901 CGGGGGCGGGGCCCGGGGTGGGG + Exonic
1090095519 11:123738979-123739001 CGAGGGCAGGGCCCACAGTGGGG - Intronic
1091088680 11:132748629-132748651 CGAGGGAGGGGCCTGCAGGGGGG + Intronic
1100632309 12:96400629-96400651 CGGGGGCGGGGCCTGCAGGGCGG + Intergenic
1110413611 13:75228990-75229012 TGAGGGCTGGGCCCTCATTTTGG + Intergenic
1119322393 14:73739677-73739699 CCAGGGCGGGGCCCGGAGCGTGG - Exonic
1121667865 14:95686337-95686359 TGGGGGCGGGGCCGGCAGTGGGG - Intergenic
1124562928 15:30791929-30791951 CGAGGGCGGGGCCTGGGGCTGGG - Intergenic
1124960373 15:34389294-34389316 CGAGGGCGGGGCCTGGGGCTGGG + Intronic
1124977002 15:34535515-34535537 CGAGGGCGGGGCCTGGGGCTGGG + Intronic
1125429339 15:39580449-39580471 CGTCGGCGGGGCCGGCAGGTTGG - Intergenic
1129687926 15:77696883-77696905 CATGGGCGGGGCCCACAGATGGG + Intronic
1130540369 15:84817418-84817440 CGAGTGCGGGGCCGGCGGTCGGG + Exonic
1131517621 15:93089340-93089362 CGCGGGCGGGGCCGGCAGGGAGG + Intergenic
1136585297 16:31180545-31180567 CGAGCGCGGGGCCGGGAGTTGGG - Intronic
1142295218 16:89217402-89217424 CGCGAGCGCGGCCCGCGGTTCGG - Intergenic
1142890658 17:2940523-2940545 AGAGGGCGGGACCCGCAGCCTGG - Intronic
1143476117 17:7204828-7204850 CGAGGGAGGGGCCTGCAGCTGGG - Intronic
1145250507 17:21294507-21294529 TGAGGGCAGGGCCCCCACTTCGG - Intronic
1146062750 17:29615643-29615665 AGAAGGCGGGGTCCGGAGTTCGG + Exonic
1149477831 17:56978060-56978082 CGGGGGCGGGGCCTGCGGGTCGG - Intergenic
1151177893 17:72303568-72303590 CGAGAGCGGGGCCCGTGGGTGGG + Intergenic
1155054165 18:22170439-22170461 CCAGGGCGGGGGCAGCAGTCTGG - Intronic
1157600489 18:48890201-48890223 AGAGGGGGAGGCCGGCAGTTAGG - Intergenic
1160297446 18:77650924-77650946 CGAGGGCATGGCCGGCAGCTGGG - Intergenic
1160781612 19:880002-880024 GGACGGCGGGGCCCGCGGTGCGG + Exonic
1161401173 19:4066706-4066728 CGGGGCCGGGGCCCGAAGTTGGG + Exonic
1161994079 19:7701851-7701873 CGGGGGTGGGGGCCGCAGTGTGG - Intronic
1162907762 19:13833681-13833703 AGAGGGCGGGGCCCGCAGTCGGG + Intergenic
1163013518 19:14440261-14440283 AGAGGGCGGGGCCCTCAGCCCGG + Exonic
1163700882 19:18785936-18785958 CGGGGGCGGGGCCTGCGGTGGGG - Intronic
1163726856 19:18928038-18928060 TGAGGGCCGAGCCCGCAGGTAGG + Intronic
1166852879 19:45768800-45768822 CGAGCGCGGGGCCGGCGGCTGGG - Exonic
1167473533 19:49688016-49688038 CTAGGGTGGGACCAGCAGTTGGG + Intronic
926311675 2:11680024-11680046 GGAGGGCTGGGCCCAGAGTTGGG + Intronic
927779358 2:25927091-25927113 CGAGGGCTGGGCCCGAGGTATGG - Exonic
927988214 2:27428610-27428632 CGAGGGCGGGGCCCGCAGTTCGG + Exonic
930076408 2:47409115-47409137 GGAGGGCAGGGCCAGCAGTAAGG + Intronic
932722520 2:74148092-74148114 AGAGGGCGGGGCCCCGAGGTCGG - Intergenic
933875996 2:86622943-86622965 CGAGGGCGGGGGCCGCGGCTCGG + Exonic
936125702 2:109787655-109787677 CGAGGGCAGGGGCAGCAGGTGGG + Intergenic
936218991 2:110583813-110583835 CGAGGGCAGGGGCAGCAGGTGGG - Intergenic
944273136 2:197805105-197805127 CGAGGGCGCGGCCGGCAGGGAGG + Exonic
944701383 2:202249375-202249397 CGGGGGCGGAGCTTGCAGTTAGG - Intergenic
945699474 2:213152026-213152048 CGGGGGCGGGGTCCGCAGTCCGG - Intronic
948953882 2:241272594-241272616 CGCGGGCGGGGGCCGCAGCCTGG + Intronic
1168965498 20:1895561-1895583 AGAGGCCTGAGCCCGCAGTTTGG - Intronic
1172443411 20:34980757-34980779 CGAGGTCGGGGTCTGCGGTTGGG - Intronic
1174264056 20:49318711-49318733 CGAGGGCGGGGCGCGGCGCTTGG + Intergenic
1178691581 21:34754526-34754548 CGAGGGTGGGGGCCGCAGGGCGG - Intergenic
1181583285 22:23839402-23839424 CGTGGGCGGGGCGCGGAGTGTGG + Intergenic
1183752736 22:39731223-39731245 CGAGGGTGGGGCCCTCATGTGGG + Intergenic
1183956224 22:41382103-41382125 CGGGGCCGGGGCGCGCAGCTGGG + Exonic
1185285834 22:49999625-49999647 CGGGGGCGGGGCGCGGAGGTGGG + Intronic
1185285854 22:49999665-49999687 CGGGGGCGGGGCGCGGAGGTGGG + Intronic
953975751 3:47380733-47380755 GGCGGGCGGGACCCGCAGCTGGG + Intergenic
954130295 3:48557157-48557179 CCAGGGCGGAGCCCGTAGGTGGG - Intronic
954437473 3:50503676-50503698 AGAGGGCGGTGCCGGCAGGTTGG - Intronic
961150349 3:124632471-124632493 GGAGGGCTGGGCCTGCAGGTTGG - Intronic
962301811 3:134250386-134250408 CGAGGCCGGGGCGGGCAGGTCGG - Intronic
968729124 4:2261538-2261560 CGAGGGCGGGGCCGGCCGGGCGG + Intronic
980969985 4:139558591-139558613 CGACGGCGGGGGCCGGGGTTGGG - Intronic
981745544 4:148049209-148049231 CCAGGGTGGGGCCAGCAGTGTGG - Intronic
985694985 5:1335188-1335210 TGAGGGCAGGGCCCTCAGTGTGG - Intronic
986974814 5:13382259-13382281 AGAGGGTGGGGCCCTCAGCTGGG - Intergenic
989102764 5:37836949-37836971 CGAGGGCGGGAACCGCAGCCGGG - Intronic
1012263299 6:97112128-97112150 TGAGGGTGGGGCCCTCAGTGGGG + Intronic
1014798373 6:125749874-125749896 CGCGGGAGCGGCCCGCAGCTCGG + Intronic
1017470611 6:154733986-154734008 CGAGGCCGGGGCCCGGAGGGTGG + Intronic
1018713687 6:166515326-166515348 CCCGGGAGGGGCCCGCAGCTGGG + Intronic
1023286949 7:38630844-38630866 CGGGGACGCGGCCCGCAGATCGG - Intronic
1023801492 7:43838942-43838964 CCAGCGCCGGGCCCGCAGTGAGG - Intergenic
1028477357 7:91266038-91266060 CGAGGACGGGGCACGCACTGTGG + Exonic
1029149645 7:98470781-98470803 ATGGGGCGTGGCCCGCAGTTGGG - Intergenic
1033236285 7:139640408-139640430 AGAGGGCGTGGCCCGCACTTGGG + Intronic
1035601002 8:896607-896629 CGAGGGTGGGGCCCCCATGTTGG + Intergenic
1037459457 8:19094481-19094503 CCAGGGCGGGGCACTCAGGTTGG + Intergenic
1041919776 8:63168723-63168745 CGAGCGCGAGGCCCTCATTTTGG + Exonic
1042021886 8:64377849-64377871 GGAGCGCGGGGCCCGCAGCCCGG - Intergenic
1049452516 8:142669821-142669843 CGCGGGCGGGAGCCGCAGTCTGG - Intronic
1052837826 9:33264755-33264777 CGAGGGCGGGGCCGGCAGGCCGG - Exonic
1057868053 9:98696937-98696959 CGAGGGAGAGGCAAGCAGTTGGG + Intronic
1060816767 9:126639215-126639237 AGAGGGTGGGGCCCCCAGATGGG + Intronic
1061273277 9:129556024-129556046 CGGGAGCAGGGCCAGCAGTTGGG + Intergenic
1061497226 9:130981930-130981952 GGAGGGCGGGGGCCGCAGGGAGG - Intergenic
1061765337 9:132878081-132878103 CGCGGCCGGGACCCGCAGCTGGG - Intronic
1189323496 X:40099372-40099394 CGAAGTCCGGGCCCGCAGTCTGG - Intronic
1190736107 X:53256707-53256729 CGAGGGCAGGGCCAGCAGCAGGG + Intronic
1192344496 X:70290007-70290029 CGAGGGCGGAGCGCGCACGTCGG - Intronic
1200155470 X:153972519-153972541 CGAGGGCGGGCCCCGCAGCCTGG - Exonic
1202366383 Y:24168595-24168617 CCAGGGCGGGGCCCGGGGCTGGG - Intergenic
1202504398 Y:25501528-25501550 CCAGGGCGGGGCCCGGGGCTGGG + Intergenic