ID: 927990920

View in Genome Browser
Species Human (GRCh38)
Location 2:27446338-27446360
Sequence CCTGGCAGCCACGGTTTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927990920 Original CRISPR CCTGGCAGCCACGGTTTCCT GGG Exonic