ID: 927991435

View in Genome Browser
Species Human (GRCh38)
Location 2:27450225-27450247
Sequence GCACCCTCCTGGGCAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927991426_927991435 20 Left 927991426 2:27450182-27450204 CCTCCAGATGCCAACTTTTTCTC 0: 1
1: 0
2: 2
3: 20
4: 236
Right 927991435 2:27450225-27450247 GCACCCTCCTGGGCAAAACCTGG 0: 1
1: 0
2: 4
3: 11
4: 167
927991429_927991435 -10 Left 927991429 2:27450212-27450234 CCCCTTCAACCTTGCACCCTCCT 0: 1
1: 0
2: 0
3: 35
4: 321
Right 927991435 2:27450225-27450247 GCACCCTCCTGGGCAAAACCTGG 0: 1
1: 0
2: 4
3: 11
4: 167
927991427_927991435 17 Left 927991427 2:27450185-27450207 CCAGATGCCAACTTTTTCTCTTA 0: 1
1: 0
2: 2
3: 30
4: 242
Right 927991435 2:27450225-27450247 GCACCCTCCTGGGCAAAACCTGG 0: 1
1: 0
2: 4
3: 11
4: 167
927991428_927991435 10 Left 927991428 2:27450192-27450214 CCAACTTTTTCTCTTACTCTCCC 0: 1
1: 0
2: 13
3: 98
4: 1139
Right 927991435 2:27450225-27450247 GCACCCTCCTGGGCAAAACCTGG 0: 1
1: 0
2: 4
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927991435 Original CRISPR GCACCCTCCTGGGCAAAACC TGG Intronic
900562194 1:3312634-3312656 GCACCCTCCTGTGCAGAACCCGG + Intronic
902078420 1:13805073-13805095 GAACCCTCCTCTGTAAAACCAGG + Intronic
903905910 1:26686392-26686414 CCACACTCCTGGGCAACACATGG - Intergenic
905120641 1:35679289-35679311 TCACCCTCCTGAGCAGAAGCTGG + Intergenic
905561687 1:38932203-38932225 GCAACCTCCTGAGCCAGACCAGG - Intronic
906578776 1:46916848-46916870 CCACCCTCCTAGGTTAAACCAGG - Intergenic
906594777 1:47065958-47065980 CCACCCTCCTAGGTTAAACCAGG + Intergenic
912930747 1:113958183-113958205 ACACCCTGCTGGGCAACTCCAGG - Exonic
913972083 1:143423361-143423383 GCACCCTCCTGGGCATGGCGGGG + Intergenic
914066464 1:144248974-144248996 GCACCCTCCTGGGCATGGCGGGG + Intergenic
914112689 1:144717380-144717402 GCACCCTCCTGGGCATGGCGGGG - Intergenic
915509340 1:156378037-156378059 GTGCCGTCCTGGGCAAGACCGGG + Exonic
915821393 1:159027744-159027766 CAACCCTCCTGGGTTAAACCAGG - Intronic
919029946 1:192228428-192228450 ACACACTTCTGGGCAAGACCTGG - Intergenic
920122480 1:203669106-203669128 TCAACCTCCAAGGCAAAACCTGG - Intronic
920185690 1:204157887-204157909 GCCCTCTCCTCTGCAAAACCTGG + Intronic
923241299 1:232088157-232088179 GCACCAGCTTGGGCAAAACAGGG - Intergenic
923278312 1:232417578-232417600 GCTCCCTACTGGGCAAAGACTGG + Intronic
923800017 1:237199625-237199647 GCACCCTCATAGGCACACCCAGG + Intronic
924768154 1:247053300-247053322 GAACTTTCCTGGGCAAAATCTGG - Intronic
1068378637 10:56217161-56217183 GAATCCTCCTGGGCTAAACCCGG + Intergenic
1070329233 10:75405927-75405949 GCACACTCCTGGGGCAACCCGGG - Intergenic
1073068817 10:100780672-100780694 GCACACTCCTGGGGAACATCAGG + Intronic
1075551517 10:123395998-123396020 GCATCCTGATGGGGAAAACCAGG + Intergenic
1083168296 11:60905690-60905712 GCATCCTCATCTGCAAAACCAGG + Intronic
1084411752 11:69009809-69009831 ACACCCGTCTGGGCAAGACCAGG + Intronic
1084450274 11:69232778-69232800 GCCCCCTCCTGGGGATAAGCCGG + Intergenic
1084490893 11:69477717-69477739 GCACCCTGCAGGGCGAAACTGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085189234 11:74603490-74603512 CAACCATCCTGGGCAAACCCAGG - Intronic
1086300740 11:85423929-85423951 GAAGCCTCCTGGCCAGAACCTGG - Intronic
1086995116 11:93347498-93347520 GCATCATCCTGACCAAAACCTGG - Intronic
1087965116 11:104403326-104403348 GTACCATCATGGGCAGAACCAGG + Intergenic
1089604200 11:119632261-119632283 GGGCCCTGCTGGGGAAAACCTGG + Intronic
1094447420 12:30546523-30546545 GCAACCTCCTGGCCAGAACTTGG - Intergenic
1096233495 12:49910493-49910515 GCTCCCTCCTGGGTATAGCCGGG + Intergenic
1098960987 12:76739488-76739510 GAAGCCTCCTGGCCAGAACCAGG - Intergenic
1101726962 12:107395799-107395821 GCTCCCTCCTGTGCAAAAATGGG - Intronic
1101727001 12:107396050-107396072 GCCCCCTCCTGGCCTAAGCCTGG + Intronic
1102839743 12:116106009-116106031 GCACCCTCCTGGGTATGACTTGG - Intronic
1103392460 12:120584549-120584571 GCACCCTCCTGGGCCAGAAGGGG - Intergenic
1103947211 12:124533108-124533130 GCTCCCTCCAAGACAAAACCTGG + Intronic
1103988142 12:124780760-124780782 GCACCTCCCTGGACATAACCAGG - Intronic
1104489094 12:129178841-129178863 GCAGCCACCTGGCCAAACCCAGG - Intronic
1105836731 13:24218355-24218377 GCTACCTCCTGGCCAGAACCTGG - Intronic
1110561798 13:76917746-76917768 GAAGCCTCCTGGCCAGAACCAGG + Intergenic
1113239908 13:108326033-108326055 ACAGACTCCTGGGCAAGACCAGG - Intergenic
1113456757 13:110454950-110454972 TCACCCTCCTGCACAAACCCGGG + Intronic
1113802234 13:113092641-113092663 GCACCTTCCTGGCCATCACCCGG + Intronic
1116463969 14:45211362-45211384 GCACCATCCTGGGCTCAACCAGG - Intronic
1117639768 14:57785907-57785929 GAAGCCTCCTGGCCAGAACCTGG + Intronic
1118166853 14:63345171-63345193 GCACCCTCATGGTCACAACATGG + Intergenic
1118882838 14:69843391-69843413 CCATCCACCTGGGCAAAGCCAGG + Intergenic
1121017970 14:90559944-90559966 CCACCATCCTGGGCAATTCCAGG + Intronic
1121280497 14:92694025-92694047 TCTCCCTCCAGGGCAAAACGCGG + Intergenic
1121483005 14:94292792-94292814 GCACCTTCCTAGACAGAACCTGG + Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1122763519 14:104048637-104048659 GCACACACGTGGGAAAAACCTGG - Intronic
1124822091 15:33056342-33056364 GCAGTCTCCTGGGCCAAAGCAGG + Intronic
1126631518 15:50741248-50741270 GCTCCCTCCTGGGCAAATCCTGG + Intronic
1127614730 15:60672617-60672639 TCACCCAGCTGGGCAAAGCCTGG - Intronic
1128650078 15:69404827-69404849 GCAGACTCCTAGGGAAAACCAGG + Exonic
1128890793 15:71330136-71330158 GTGCCCTCCTGGGCCAAACGAGG + Intronic
1128965253 15:72051853-72051875 GCAGGCTCCTGGGCAAAAGGAGG + Intronic
1129097660 15:73225790-73225812 GAACCCTCCTGGCCAGAACTCGG - Intronic
1129175436 15:73836619-73836641 ACACCCTACTGGCCAGAACCTGG - Intergenic
1129247020 15:74285553-74285575 GCAGCCTCGGGGGCAAAGCCAGG - Intronic
1129271115 15:74419712-74419734 GCATCCTCATGGGTGAAACCAGG - Intronic
1132677767 16:1127692-1127714 CCAACCTCCTGGGCAAAACGAGG - Intergenic
1132879149 16:2153699-2153721 GCCCCCTCCTGGGCACGTCCAGG + Exonic
1136181646 16:28556844-28556866 GGACCATCCTGGGCAACACACGG - Intronic
1137484335 16:48879105-48879127 GGTTCCTGCTGGGCAAAACCAGG + Intergenic
1141906333 16:87029184-87029206 GCTCCCTCCAGGGCCACACCTGG + Intergenic
1142177216 16:88650815-88650837 GCACCCTCCTGGCCTGACCCCGG + Intronic
1143497243 17:7319237-7319259 ACAGCCTCCTGGGAAGAACCAGG + Intronic
1143645223 17:8225637-8225659 GCACCCTGCTGCACGAAACCTGG + Intergenic
1143858978 17:9874158-9874180 GCACCCTCCAGGGCTATGCCGGG - Intronic
1144160295 17:12551377-12551399 GCATCCTTCTGGGTAAAATCTGG + Intergenic
1144495500 17:15742584-15742606 GCCCCCTCTTGGGCAGAGCCTGG - Intronic
1148051665 17:44772659-44772681 GCCCCATCCTGGGCAAACCGAGG + Intronic
1148906767 17:50917310-50917332 ACTCCCTCCTGGGGAAATCCTGG - Intergenic
1151954207 17:77372683-77372705 GCACCCTCCTGGGTGAGCCCTGG - Intronic
1152183583 17:78840507-78840529 GGACCCTCCTCGGGAATACCCGG + Exonic
1153310373 18:3671875-3671897 GCACCCCCTTGGGCAAAACCTGG + Intronic
1158882603 18:61795421-61795443 GCACCCTCATCTGAAAAACCAGG + Intergenic
1160021455 18:75184995-75185017 GCACCCACCTGGGCAGAGCCAGG - Intergenic
1160663630 19:312856-312878 CCACCCTCCTGGGCAATGTCAGG + Intronic
1160933462 19:1581800-1581822 GCACTCTCCTGGGCAACAGAGGG - Intronic
1161456294 19:4371306-4371328 ACACCCCTCTGGGTAAAACCTGG - Intronic
1163109225 19:15148905-15148927 GCACCCTCTTGGGCATCACATGG + Intergenic
1163766485 19:19166093-19166115 GCCCACTCCTGTGCAAAACAGGG - Intronic
1164033730 19:21434959-21434981 TCAGCCTCCTGGGCAAACCAGGG + Intronic
1164149966 19:22542251-22542273 GGACCATCCTGGGCAAAATGGGG - Intergenic
1164385690 19:27769123-27769145 GGAAACACCTGGGCAAAACCAGG - Intergenic
1166630029 19:44398429-44398451 GCAACCTCTAGGGAAAAACCTGG - Intronic
1166637427 19:44463005-44463027 GCAACCTCTAGGGAAAAACCTGG + Intergenic
925019562 2:558006-558028 CCACCCCCTTGTGCAAAACCCGG + Intergenic
925768126 2:7257586-7257608 GCACCCCCCTGGGCTGAAGCAGG - Intergenic
925918581 2:8624317-8624339 GCGACCACCTGGGCAAAGCCAGG + Intergenic
927991435 2:27450225-27450247 GCACCCTCCTGGGCAAAACCTGG + Intronic
929084797 2:38157807-38157829 GCACCATCCCGGGCAGAACTAGG - Intergenic
930133550 2:47878056-47878078 ACAGCCTCCTGGGTAAAAGCTGG - Intronic
930807657 2:55507430-55507452 GGACCCTCCTGGGCAACACGGGG - Intergenic
930839174 2:55826297-55826319 GCACCCTCCTGCTCATCACCAGG + Intergenic
931765553 2:65452932-65452954 GCAATATCCTGAGCAAAACCAGG - Intergenic
931849448 2:66237675-66237697 GCTGCCTCCTGTGCAAAACTAGG + Intergenic
933111027 2:78400539-78400561 CAACCCTCCTGGCCTAAACCAGG + Intergenic
935561910 2:104568196-104568218 GCATCATCCTGAGCAAAAGCAGG - Intergenic
936002169 2:108843974-108843996 TCACCCTCCTGGGCTCAAGCTGG + Intronic
936291945 2:111232776-111232798 GGACCAGCCTGGGCGAAACCTGG - Intergenic
938543729 2:132308080-132308102 GCAACCTCTAGGGAAAAACCTGG + Intergenic
940499444 2:154475994-154476016 GCAGCCTCCTGAGCCAAAACAGG + Intergenic
940618747 2:156084132-156084154 GAAGCCTCCTGGGCAGAACTTGG - Intergenic
941631691 2:167891453-167891475 GCAGCCTCCTGGCCAGAACTCGG - Intergenic
944775693 2:202962291-202962313 AGACCCACCTGGGCAAAACAGGG + Intronic
946340309 2:219062245-219062267 GCACCTGCATGGGCAAAAACTGG - Intergenic
947691273 2:232138695-232138717 TCACACTCCTGGTCAAAGCCTGG - Intronic
1171238702 20:23548085-23548107 GCAGCCTCCAGGGGAAACCCAGG + Intergenic
1171872593 20:30540806-30540828 GCAACCTCTAGGGAAAAACCTGG + Intergenic
1171978886 20:31612972-31612994 GCCCCCTCCCGGGCAGAGCCCGG + Intergenic
1179658979 21:42862728-42862750 GCACCCTCCTGCCCAACACTGGG + Intronic
1181910576 22:26235172-26235194 CCACCCTCCTGTCCCAAACCAGG - Intronic
1182658307 22:31906893-31906915 GCACACTCCTGGGCAAGAAGTGG - Exonic
1184017889 22:41799904-41799926 GCACCCTCGTGGGTAGATCCTGG + Intergenic
1184916264 22:47571114-47571136 CCTGCCTGCTGGGCAAAACCAGG + Intergenic
950610226 3:14122068-14122090 GAACCATCCTGGGCAAAGCCTGG + Exonic
950651349 3:14409321-14409343 GCACCCTCCGGGGCAAGTCCTGG - Intronic
953879404 3:46683876-46683898 CCACCCTCCTGGACAAAGCTGGG - Intronic
954662496 3:52233549-52233571 GGACCCTCCTGGGCAGTCCCAGG + Intronic
957832894 3:85546198-85546220 GCACCATGCTGGGCAAATCTTGG + Intronic
959637381 3:108590053-108590075 ACACCCTCCGGAGCAATACCTGG - Intronic
961841455 3:129716665-129716687 GCACCTTCATGGGCAGAACTAGG - Intronic
962426541 3:135273673-135273695 GCTGCCTCCTTGGTAAAACCGGG + Intergenic
962745371 3:138394147-138394169 GCTCCCTCCTGGGAAATACTGGG + Intronic
967784637 3:193478553-193478575 CAACCCTCCTAGGCTAAACCAGG + Intronic
968606213 4:1536900-1536922 GCACCCTGCTGGGCAAAAAATGG - Intergenic
969574959 4:8031300-8031322 GCACACTCCTGGGAAGAGCCTGG - Intronic
971332894 4:25697057-25697079 CCACCCTCCTGGGGAAGACCAGG + Intergenic
979158256 4:117425799-117425821 GCATCATCCTGATCAAAACCTGG - Intergenic
981346568 4:143683652-143683674 GAAGCCTCCTGGCCAGAACCCGG + Intronic
985840801 5:2303854-2303876 CCGCCCTCCCAGGCAAAACCTGG - Intergenic
990603903 5:57388062-57388084 TGGCCCTGCTGGGCAAAACCAGG + Intergenic
990990049 5:61675486-61675508 GCACTCTCCTGGGCAGTGCCAGG + Intronic
1000581322 5:163038379-163038401 GCAACCACCTGGGCCAGACCAGG - Intergenic
1003450809 6:6230084-6230106 GAAGCCTCCTGGCCAAAACTTGG + Intronic
1005249245 6:23925982-23926004 GCACTCTCCTTGGCAAAGTCTGG + Intergenic
1011329128 6:86184188-86184210 GAACACTCCTGGCCAAAACTCGG - Intergenic
1015362432 6:132355150-132355172 GAAGCCTCCTGGCCAGAACCTGG - Intronic
1015849858 6:137560467-137560489 GGAGCCTCCTGGCCAGAACCTGG - Intergenic
1018899886 6:168045735-168045757 GCTTCCTCCTCGGCAAAGCCAGG + Intergenic
1020357061 7:7289489-7289511 GGACCCTCCTGGGCAAAACAGGG - Intergenic
1023093769 7:36640157-36640179 TCCCCCTCCTTGGCAAAAGCTGG - Intronic
1023159773 7:37285774-37285796 GGTCCCTTCTGTGCAAAACCAGG - Intronic
1025204711 7:56985515-56985537 CCACCCTCCTGGGGAAAGGCGGG + Intergenic
1025667226 7:63591420-63591442 CCACCCTCCTGGGGAAAGGCGGG - Intergenic
1026849113 7:73713961-73713983 CCTGCCTCCTGGCCAAAACCAGG + Intronic
1029863270 7:103598469-103598491 GCAAACTCCTGTGAAAAACCTGG + Intronic
1030984459 7:116224726-116224748 CCTCCATCCTAGGCAAAACCTGG - Intronic
1032871246 7:135988341-135988363 GCACCTTCCTGGACAGAACTAGG - Intergenic
1034908576 7:154973130-154973152 GCACCCACCTGGACAATCCCTGG + Intronic
1037338349 8:17813820-17813842 GCACCTTTCTGTGTAAAACCTGG - Intergenic
1037680997 8:21097287-21097309 CCACCATGCTGGGCAACACCTGG - Intergenic
1037949216 8:23007855-23007877 GCTCCCAGCTGGGGAAAACCAGG - Intronic
1038869820 8:31481786-31481808 GCACCCTCCAGGGAAAAATCAGG - Intergenic
1045504687 8:102770089-102770111 GCTCCTTCCTGGGCAGCACCTGG - Intergenic
1045885793 8:107096629-107096651 GAACCCTCCTGGGCACAGTCAGG + Intergenic
1047313057 8:123708458-123708480 GCAGCCTCCTGGGCCCAGCCAGG - Intronic
1052731533 9:32291562-32291584 GAAGCCTCCTGGCCAGAACCTGG - Intergenic
1056455362 9:86754461-86754483 TCACTCTCCAGTGCAAAACCTGG - Intergenic
1056580866 9:87887378-87887400 GCAGCCTTGTGGGCAGAACCTGG + Exonic
1057195433 9:93113713-93113735 GCACCTTCTGGGGCAAAGCCTGG - Intergenic
1060424685 9:123494354-123494376 GCACCCTCTTGGATCAAACCTGG + Intronic
1060746021 9:126131455-126131477 GCTTCCTCTTGCGCAAAACCTGG - Intergenic
1060933736 9:127504386-127504408 ACACCCTCCTGGGCTCAACTTGG + Intergenic
1061257884 9:129463402-129463424 GCTCCATCCTGGGCAAATCATGG + Intergenic
1062318699 9:135980098-135980120 CCACCCTCCTGGGCCAGGCCTGG - Intergenic
1062357093 9:136170159-136170181 CCTCCCTCCTGGGCAAGCCCGGG + Intergenic
1186138971 X:6550789-6550811 TCACGCCCCTGGGGAAAACCTGG + Intergenic
1189025778 X:37392443-37392465 CCACCCACCTGGGCAAAGCTAGG - Intronic
1189962088 X:46333588-46333610 GAAGCCTCCTGGCCAGAACCTGG + Intergenic
1192456044 X:71276708-71276730 CCACCCGCCTCGGCAAAACCTGG + Intergenic
1197641027 X:128968223-128968245 GCACCTTCCTGGCCATAAGCAGG - Intergenic
1198811785 X:140543373-140543395 TCACCATCCTGGGCTAAAACTGG - Intergenic