ID: 927992540

View in Genome Browser
Species Human (GRCh38)
Location 2:27458255-27458277
Sequence ATCCAATTCCCCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927992535_927992540 12 Left 927992535 2:27458220-27458242 CCAGCTGTGGAGGCACAGAGGCA 0: 1
1: 0
2: 6
3: 51
4: 303
Right 927992540 2:27458255-27458277 ATCCAATTCCCCAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927992540 Original CRISPR ATCCAATTCCCCAGGGAAGC AGG Intronic
900118789 1:1039949-1039971 TTGCACTTCTCCAGGGAAGCTGG + Intronic
900549327 1:3246288-3246310 TTCCAAGTGCCCAGGGCAGCAGG + Intronic
901316691 1:8314751-8314773 AGCCAGGGCCCCAGGGAAGCAGG - Intergenic
903301174 1:22379726-22379748 ATCCACTTACCCAGGGATTCAGG - Intergenic
904781373 1:32951569-32951591 TTCCAGTTCCACAGTGAAGCTGG + Intronic
904998847 1:34652401-34652423 AGACAATTCCACAGGGAAGCTGG - Intergenic
908825887 1:68132268-68132290 TTCCCATTCCCCAGTGAAGGTGG - Intronic
912792912 1:112670724-112670746 AACAAGTTCCCCAGAGAAGCTGG - Exonic
915271052 1:154753783-154753805 TTCCTAATCCCCTGGGAAGCAGG + Intronic
916876862 1:168978785-168978807 ATCCATTTCCACAGGAAACCGGG + Intergenic
919281633 1:195496499-195496521 ATACAGTTCACCAGGGAAGTGGG + Intergenic
919515481 1:198516688-198516710 ATCCAACTCCCTAGGAAACCTGG - Intergenic
921843920 1:219859112-219859134 AAACAATTCTCCAGGGAAGGAGG - Intronic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
923122231 1:231002651-231002673 ATCTAGTTCACCAGGGAAGTGGG - Intergenic
924439882 1:244077378-244077400 TTCCAATACCGGAGGGAAGCTGG + Intergenic
1062902382 10:1156157-1156179 CTCCACATCCCCAGGGTAGCTGG - Intergenic
1067266811 10:44753446-44753468 ACCCACTTTCCCAGGGAGGCTGG + Intergenic
1068076526 10:52262675-52262697 AACCAATCCCCCATGGATGCTGG - Intronic
1069530943 10:69218988-69219010 ATCTCAATCCCCAGGGTAGCTGG - Intergenic
1069883859 10:71611072-71611094 ATCCAATTCCCATGGGGGGCTGG - Intronic
1070683605 10:78465875-78465897 ACCTAACTCCCCAGGGAAGCAGG - Intergenic
1074815332 10:117137843-117137865 ATCCAATTCCGCAGCGGACCCGG - Exonic
1075474609 10:122723442-122723464 ATCCAATTCCCAATGGAAAAAGG + Intergenic
1076409002 10:130232652-130232674 TTCCCCTTCCCCAGGGCAGCTGG - Intergenic
1078085218 11:8229799-8229821 ATCCATTTGCCCAGGGAAACTGG - Intronic
1081624742 11:44645421-44645443 GTCGGATTCCCCAGTGAAGCTGG - Intergenic
1083253126 11:61481258-61481280 AGCCAATTCCCAGGGGAGGCAGG + Intronic
1084581209 11:70024583-70024605 TTGCAATACCCCTGGGAAGCTGG + Intergenic
1084702976 11:70799652-70799674 AGCCAATTCCCCAGGAGAGAAGG + Intronic
1086035577 11:82410165-82410187 ATCCTATCCCACAGAGAAGCAGG + Intergenic
1086529331 11:87765138-87765160 CTTCAATTCCACAGGGAAGGAGG - Intergenic
1087902005 11:103651433-103651455 ATCCAGGTCACCAGGGAAGAGGG - Intergenic
1088906010 11:114156052-114156074 ATCCAATTCCAGAGGGAGGAAGG - Intronic
1089338756 11:117743601-117743623 GCCCAGTTCCCCAGGGCAGCAGG + Intronic
1089586236 11:119511672-119511694 ATCCAAGTCCCTAGGGTGGCTGG - Intergenic
1089729148 11:120509896-120509918 ATCCTATTAACCAGGGAAGCGGG - Intergenic
1090660921 11:128880906-128880928 ATCCCTTTCCCCAGAGAACCTGG - Intergenic
1094716520 12:33019631-33019653 ATACAATTCCCCAAGGATGAAGG + Intergenic
1096547612 12:52351436-52351458 ACCCAAAGCCCCAAGGAAGCTGG - Intergenic
1097057931 12:56261190-56261212 CTCCAATTGCCCAGAGAACCAGG - Intergenic
1098179437 12:67830513-67830535 AACTAATACCCCAGGGAAACTGG + Intergenic
1099041973 12:77667486-77667508 ATACAGGTCCCCAGGGAAGTGGG - Intergenic
1099479900 12:83152477-83152499 TTGCAATTCCCCTGTGAAGCTGG - Intergenic
1100725692 12:97406128-97406150 AACCAATCCCCCAGGGAAGCAGG - Intergenic
1102310852 12:111842970-111842992 ATCACACTCACCAGGGAAGCTGG - Intronic
1104392661 12:128404219-128404241 ATCCAATTCAAGAGGGAAGCAGG + Intronic
1104717124 12:131023438-131023460 ACCCACTTCCCCAGGTAAGCCGG + Intronic
1105579463 13:21680959-21680981 CTCCAAAACCCCAGGGATGCTGG + Intronic
1107959868 13:45548181-45548203 TTCCATTTCCTCAGGGAAGATGG - Intronic
1109922711 13:69089903-69089925 ATATCATTCCCAAGGGAAGCAGG + Intergenic
1110354759 13:74554746-74554768 ACCCAATTCTCCAAGGTAGCTGG + Intergenic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1114477722 14:23009552-23009574 ATTCATTTCCCTAGGGAAGGGGG - Intronic
1116492867 14:45526828-45526850 CTCCAATCCTGCAGGGAAGCAGG - Intergenic
1119750915 14:77076685-77076707 AAACAATTCCCCAGGGATGATGG + Intergenic
1119863728 14:77956016-77956038 ATCCACTTTACCAGGGATGCAGG + Intergenic
1120712715 14:87809507-87809529 CTCCAATTCCCCTTGGAATCTGG - Intergenic
1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG + Intergenic
1123979103 15:25583066-25583088 AGCTACTTCTCCAGGGAAGCAGG - Intergenic
1126648912 15:50902149-50902171 ATCCATTTCCCCAAGGAATGTGG - Intergenic
1128660425 15:69497042-69497064 ATCCCATTCCCCAGGGGAAAGGG + Intergenic
1128693290 15:69741957-69741979 ATCCATTTTCCCAGGGAGGCTGG - Intergenic
1129370774 15:75093352-75093374 ATACCATTCACCAGAGAAGCTGG + Intronic
1130520052 15:84655155-84655177 CACCAATTCAACAGGGAAGCAGG + Exonic
1131156673 15:90080092-90080114 CTCCCACTCCCCACGGAAGCAGG - Exonic
1131984291 15:98025766-98025788 ATACGATATCCCAGGGAAGCTGG - Intergenic
1133321741 16:4918371-4918393 GTCTCATTCTCCAGGGAAGCTGG + Intronic
1133413882 16:5590765-5590787 ACCCAATGCTCCAGGCAAGCTGG - Intergenic
1133773372 16:8880561-8880583 TTCAAAATCCCCAGGGAAGGAGG + Intergenic
1136049340 16:27639294-27639316 AGCCCATTCCACAGGGAAGGTGG - Intronic
1137034674 16:35559696-35559718 TTAAAATTCCCCAGGTAAGCAGG + Intergenic
1137339483 16:47586112-47586134 AAACAAGTCCCCAGGGAAGTTGG - Intronic
1138446148 16:57065409-57065431 TTCCATGTCCCCAGGGTAGCAGG + Intronic
1139794669 16:69472752-69472774 ATCCAGTTCCACAGTGAAACGGG - Intergenic
1140563164 16:76008231-76008253 ATTCTATTCTCCAGGCAAGCAGG + Intergenic
1142070136 16:88087299-88087321 ATCCAACCCCCCGGGGAAGATGG - Intronic
1143373161 17:6452913-6452935 TTCAAATTCCCCAGGGATCCTGG + Exonic
1144728857 17:17515289-17515311 AGCCATGCCCCCAGGGAAGCTGG - Intronic
1145818115 17:27810234-27810256 ATGCAGGTCCTCAGGGAAGCAGG - Intronic
1146287134 17:31581585-31581607 ACCCAGCTCCCCAGGGAACCTGG - Intergenic
1147627875 17:41911398-41911420 TTCTTATTCCCCAGGGGAGCTGG - Intronic
1147781614 17:42947003-42947025 ATCCAATGCCCCAGGGAGAGGGG - Intergenic
1150534885 17:66026614-66026636 CACCAATTCCCCATGGATGCTGG - Intronic
1150608642 17:66715219-66715241 ACCCAGTTCCCCAAGGAAGAAGG - Intronic
1153521091 18:5954541-5954563 ATATATTTCCCAAGGGAAGCAGG - Intergenic
1154018289 18:10639275-10639297 ATCCAATCCCTCAAGGCAGCTGG + Intergenic
1154156653 18:11949013-11949035 ATCTAATTCCCCTATGAAGCTGG + Intergenic
1154186582 18:12190315-12190337 ATCCAATCCCTCAAGGCAGCTGG - Intergenic
1155606479 18:27612155-27612177 GTCAAATTCTCCATGGAAGCCGG + Intergenic
1160350094 18:78170891-78170913 AACCAATTCCCCAGGGTCACGGG + Intergenic
1161491864 19:4566710-4566732 ATGCAAGTCCCCAGGGTTGCAGG - Intergenic
1164895409 19:31873164-31873186 ATGCAATTCCCCATGGTACCTGG + Intergenic
1165175283 19:33925070-33925092 ATCCAATTCTGCTGGGAAGATGG + Intergenic
1166844095 19:45716278-45716300 AACCAACTGCCCAGGGAGGCAGG + Intronic
1167058441 19:47128267-47128289 ATCCACTTCCCCAGGGAGTTCGG + Intronic
1167380769 19:49136761-49136783 GTCCAGTTCCCCAGGGAATGGGG - Exonic
925187404 2:1858608-1858630 AACCAACCCCCCAGGGATGCTGG + Intronic
926239817 2:11076917-11076939 AACAAGTTCCCCAGAGAAGCTGG + Intergenic
927427052 2:22993025-22993047 ATCCCATTCCCCAGAGATACTGG - Intergenic
927650929 2:24913328-24913350 ATCCAATTCCCATGGGGAGAAGG + Intronic
927959850 2:27234322-27234344 ATCCAAGTAGGCAGGGAAGCTGG + Intronic
927992540 2:27458255-27458277 ATCCAATTCCCCAGGGAAGCAGG + Intronic
928472709 2:31589998-31590020 ATACATGTCACCAGGGAAGCGGG - Intergenic
932475343 2:72002481-72002503 TTTCAACACCCCAGGGAAGCAGG - Intergenic
932563122 2:72889423-72889445 ACCCTATTCCCCAGGGACACAGG - Intronic
934201084 2:89886041-89886063 ATCCAATTCTTCACAGAAGCTGG + Intergenic
935255529 2:101307130-101307152 ATACCATTCCCTAGGGCAGCAGG - Intronic
941389772 2:164897414-164897436 AGCCAAATCCACAGGGAAGCTGG - Intronic
942625956 2:177901049-177901071 ATTCTAGTCCCCAGGGAAGAAGG - Intronic
943747769 2:191480049-191480071 ATCAGATTCACCAGGGAAGCAGG - Intergenic
945783349 2:214204061-214204083 ATGCAAGTCACCAGGGAAGTGGG - Intronic
1170191525 20:13649638-13649660 ACCCAGGCCCCCAGGGAAGCCGG + Intergenic
1170585790 20:17732927-17732949 ACCCTGCTCCCCAGGGAAGCTGG - Intronic
1171415688 20:24979177-24979199 ATCCAATGCCTCAGGGCAGCTGG + Intronic
1171936111 20:31277205-31277227 ATTGAATTCCTCAGGCAAGCTGG + Intergenic
1172256426 20:33522239-33522261 ACCCAATTCTCCAAGGAACCAGG - Intronic
1174049691 20:47759030-47759052 CTCCATTTTCCCAGGGCAGCCGG + Intronic
1175677931 20:60962626-60962648 GACTGATTCCCCAGGGAAGCTGG - Intergenic
1175767818 20:61603376-61603398 ACCCAGCTCCCTAGGGAAGCTGG + Intronic
1177015473 21:15782114-15782136 TCCCTATTACCCAGGGAAGCAGG + Intronic
1177364555 21:20117355-20117377 ATACAAGTCACCAGGGAAGTGGG + Intergenic
1178940792 21:36903404-36903426 ATCACTTTCCCCAGGGCAGCTGG + Intronic
1179882000 21:44296793-44296815 ATCCACTTTCCCAGGGAGGGTGG + Intronic
1182422579 22:30255872-30255894 ACCCAGGTCCCCAGGAAAGCTGG + Intergenic
1185043081 22:48515677-48515699 ATCCAATGCCCAATGCAAGCGGG + Intronic
949258384 3:2077758-2077780 ATCCACCTCCCCAGGGAAAGGGG + Intergenic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
950566628 3:13773202-13773224 ACCCAGCTCCCCAGGAAAGCAGG - Intergenic
950587915 3:13909250-13909272 ATACAGTTCACCAGGGAAGTTGG - Intergenic
957490765 3:80923900-80923922 ATTCCATTCCACAGAGAAGCAGG - Intergenic
958787436 3:98613140-98613162 ATGCAGTTCACCAGGGAAGTGGG + Intergenic
962928159 3:140013923-140013945 CTGCAACTCCCCAGGGAATCTGG + Intronic
964640508 3:158905433-158905455 ATCCAATTCCCCTGGGAGGTGGG - Intergenic
966039165 3:175459702-175459724 CTCCAAATCCCCAGGGATGGTGG - Intronic
968047133 3:195630823-195630845 GTCGGATTTCCCAGGGAAGCTGG + Intergenic
968307514 3:197659221-197659243 GTCGGATTTCCCAGGGAAGCTGG - Intergenic
968557037 4:1250686-1250708 CCCCACTTCCCCAGGGGAGCTGG + Intergenic
968810122 4:2795992-2796014 GTCCAGTGCCCCAGGGAAGGGGG - Intronic
970662651 4:18303454-18303476 ATTAAATTCCCCTGGAAAGCAGG - Intergenic
971423472 4:26494171-26494193 CTCCAAATCCCCAGGGATGCTGG - Intergenic
973632523 4:52832882-52832904 GTGAAATTCTCCAGGGAAGCAGG - Intergenic
973661701 4:53114014-53114036 ATTCAAATCCTCAGGGAATCTGG - Intronic
973920185 4:55676101-55676123 ATCCCCATCCCTAGGGAAGCGGG + Intergenic
974684477 4:65208442-65208464 ATCCATTTTCCCAGAGAAGGTGG - Intergenic
976918128 4:90404198-90404220 ATATAATTTGCCAGGGAAGCTGG - Intronic
977777516 4:100938855-100938877 ATACAGGTCCCCAGGGAAGTGGG - Intergenic
981781157 4:148431095-148431117 ATACAATTCCTCATGGAAACAGG - Intronic
983584574 4:169341527-169341549 AGCCAAATCACCAGCGAAGCCGG + Intergenic
983661519 4:170134583-170134605 ATCCCATTCCTAAGGGAAGGGGG - Intergenic
984221665 4:176985366-176985388 ATCCAGTTCCTCAGGGATGTTGG - Intergenic
984333056 4:178351589-178351611 ATCAATTTCTCCAGGAAAGCAGG - Intergenic
985108339 4:186520935-186520957 ATACAAGTCGCCAGGGAAGTTGG + Intronic
986221986 5:5776344-5776366 ATCCATGTCCCCTGGGATGCAGG + Intergenic
986908033 5:12519313-12519335 ATTCAATACCACATGGAAGCTGG + Intergenic
987265329 5:16247393-16247415 ATCCACCTCCCCAGGGATGATGG + Intergenic
987316808 5:16731671-16731693 CTCCAATTCCACAGGGTTGCTGG - Intronic
987440623 5:17951784-17951806 ATGCAGGTCGCCAGGGAAGCAGG + Intergenic
988042914 5:25911401-25911423 ATTCATTTGCCCAGGGAAGTGGG - Intergenic
988153559 5:27418908-27418930 CTCCAATGCCATAGGGAAGCTGG - Intergenic
989170166 5:38465859-38465881 ATGCAATGACCCAGGGATGCAGG + Intergenic
989569233 5:42929769-42929791 ATGCAATTCTCCTGGGAAGGGGG - Intergenic
997828035 5:137124959-137124981 ATGAAACTCCCCAGGGAAACTGG - Intronic
1001812094 5:174636534-174636556 ATCCCACTCTCCAGGAAAGCTGG + Intergenic
1002301879 5:178262021-178262043 AGCCATTTCCCCAGGGTGGCTGG + Intronic
1002305899 5:178282730-178282752 TTCCAATGTGCCAGGGAAGCAGG - Intronic
1003279039 6:4676156-4676178 ATCAGAATCCCCTGGGAAGCTGG - Intergenic
1004122166 6:12834355-12834377 CTCAAACTCCCCAGGGAAGAAGG - Intronic
1006601387 6:35228803-35228825 TTCCTATTTCCCAGGGAAGGAGG + Intronic
1007271322 6:40639486-40639508 ATCCATGTCCCCAGGGCAGAGGG - Intergenic
1008885136 6:56424212-56424234 TTCCATTTCCCCATGAAAGCTGG + Intergenic
1010518487 6:76803344-76803366 ATACAGGTCCCCAGGGAAGTGGG + Intergenic
1011156645 6:84340908-84340930 ATGCAGGTCACCAGGGAAGCTGG + Intergenic
1011597640 6:89031485-89031507 ATCCCATTTCCTAGGGAGGCTGG + Intergenic
1012645201 6:101670363-101670385 ATGTTATTCCCCAGGGAAACTGG + Intronic
1014372394 6:120626819-120626841 CTCCAAGTCCCCAGGGAGGCAGG - Intergenic
1015701994 6:136046628-136046650 CTGCAATTCCCCAGGGTATCAGG + Intronic
1016160434 6:140872750-140872772 AACCAATCCCCCATGGATGCAGG + Intergenic
1018628130 6:165800171-165800193 ATGCAATTCCCCAAGCAAGGAGG + Intronic
1020153169 7:5699623-5699645 GTACAATTCCCCTGGGAAGATGG - Intronic
1020992414 7:15216313-15216335 TAACAATTCCCCAGGAAAGCAGG - Intronic
1022953490 7:35361028-35361050 TTCCAATAACCCAGCGAAGCAGG + Intergenic
1023091776 7:36624583-36624605 CTCCAGTTCCCAAGGGAACCTGG - Intronic
1029241761 7:99168220-99168242 CTCAAATGCCCCTGGGAAGCTGG + Intergenic
1029975337 7:104828311-104828333 CTCAAATTCCCCAGGCCAGCAGG + Intronic
1030837870 7:114311284-114311306 ATCCATTTCCCCAAAGAATCTGG - Intronic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1035372165 7:158386482-158386504 ATCCAATTCCCCTCGGGACCAGG + Intronic
1036244359 8:7103771-7103793 ATGCACTTCCCCAGCTAAGCCGG - Intergenic
1036256385 8:7209968-7209990 ATGCACTTCCCCAGGTCAGCTGG + Intergenic
1036308435 8:7668553-7668575 ATGCACTTCCCCAGGTCAGCTGG + Intergenic
1036361100 8:8077524-8077546 ATGCACTTCCCCAGGTCAGCTGG - Intergenic
1036466674 8:9004021-9004043 ATGCAATTACCAAGGGAGGCAGG - Intronic
1046791399 8:118326123-118326145 ATCCAATTCAACAGTGGAGCAGG - Intronic
1047461116 8:125066432-125066454 ATCCAAGCCCCCAGGGATACTGG + Intronic
1049361314 8:142213700-142213722 ATCCAATTACCACAGGAAGCAGG + Intronic
1049965595 9:776311-776333 ACCCTATTCCCCAGGGAAACAGG + Intergenic
1050325461 9:4492849-4492871 CTCCACTTCCACAGGGAATCAGG - Intronic
1051755125 9:20391159-20391181 ACCCAATTCCCCAGGGGAGTTGG - Intronic
1053242631 9:36508460-36508482 GTTCAACTCCCAAGGGAAGCGGG + Intergenic
1056256102 9:84800914-84800936 TTCCAATTCCCCATGGAAAAGGG - Intronic
1056687616 9:88779319-88779341 ATCCATGTCCCCAGGGAACTTGG - Intergenic
1057909191 9:99004956-99004978 CTCCACTTCCCCAGGCATGCTGG - Exonic
1057954517 9:99396894-99396916 AGCCATTTCCCCAGAGAGGCAGG + Intergenic
1058384490 9:104418199-104418221 AGCCAACTCACCAGGGTAGCAGG + Intergenic
1060523530 9:124307935-124307957 GTCCCAGTCCCCGGGGAAGCAGG + Intronic
1060529268 9:124338959-124338981 ATCCCCTTCCCCTGGGCAGCTGG + Intronic
1061500284 9:130997942-130997964 ATCCCAGGCCACAGGGAAGCAGG + Intergenic
1187006220 X:15235151-15235173 AACCAATTCCCCAAGGATACTGG + Intergenic
1187319327 X:18226269-18226291 AACGCATTCCCCAGGGGAGCTGG + Intergenic
1187389804 X:18878518-18878540 AGCCAATTCCACAGTGAGGCCGG - Intergenic
1188369331 X:29349467-29349489 ATCCCATTCTCCACGGAGGCTGG - Intronic
1189328934 X:40130916-40130938 AGCCAGCTCCCCAGGGAAGGTGG - Intronic
1191870326 X:65740061-65740083 ATTCATTTGCCCAGGGAAGTGGG - Exonic
1193974053 X:88095793-88095815 AACAAGTTCCCCAGAGAAGCTGG + Intergenic
1196569104 X:117244874-117244896 ATCTCATTCCACAGTGAAGCTGG - Intergenic