ID: 927997122

View in Genome Browser
Species Human (GRCh38)
Location 2:27494443-27494465
Sequence CATTCACAGGAGAGGGAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927997116_927997122 7 Left 927997116 2:27494413-27494435 CCGAGTTGGCTCTGAGGTGAGTG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG 0: 1
1: 1
2: 3
3: 33
4: 358
927997112_927997122 22 Left 927997112 2:27494398-27494420 CCCAGGACACAGTGGCCGAGTTG 0: 1
1: 0
2: 0
3: 16
4: 135
Right 927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG 0: 1
1: 1
2: 3
3: 33
4: 358
927997113_927997122 21 Left 927997113 2:27494399-27494421 CCAGGACACAGTGGCCGAGTTGG 0: 1
1: 0
2: 0
3: 16
4: 117
Right 927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG 0: 1
1: 1
2: 3
3: 33
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927997122 Original CRISPR CATTCACAGGAGAGGGAGGC CGG Exonic
900298788 1:1966220-1966242 CACACACAGGAGAGGGTGGCGGG + Intronic
900549538 1:3247396-3247418 AATTTACAGGCGAGGGCGGCCGG + Intronic
900565454 1:3329725-3329747 CATTCACAGGAGAGTGGGCAGGG + Intronic
900786284 1:4652820-4652842 CATTAAGAGGCGAAGGAGGCAGG - Intergenic
900875821 1:5341780-5341802 CAGGCACAGGAGAGAGGGGCTGG + Intergenic
900937303 1:5774531-5774553 CATTCATGGGAGACGGAGGGGGG + Intergenic
900946779 1:5835241-5835263 GATTCCCCAGAGAGGGAGGCAGG + Intergenic
901138940 1:7015467-7015489 CATTCAGAGGAGAGGCAGGCTGG - Intronic
901863509 1:12089436-12089458 GATGGACAGGAGAGAGAGGCTGG - Intronic
902339326 1:15772449-15772471 CATGCCCATGAGAGGGAGGGGGG + Intronic
902380558 1:16050449-16050471 CATCCCAAGGAGAGGGAAGCAGG - Intronic
902667313 1:17948657-17948679 CATGCTCGGGAGAGGGTGGCGGG - Intergenic
902688749 1:18096480-18096502 CATTCTCAGGAGATGGGGCCAGG + Intergenic
902995587 1:20222445-20222467 CATTCACTGGGGAGGGAGAGGGG + Intergenic
902995795 1:20223739-20223761 CCTGCACAGGGAAGGGAGGCAGG - Intergenic
903564929 1:24258084-24258106 CATTCACAGGACAGGGAGAGGGG - Intergenic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904779814 1:32937413-32937435 CACTCAAATGAGATGGAGGCTGG + Intronic
905587374 1:39131273-39131295 CTTACTCAGGAGATGGAGGCAGG - Intronic
905782377 1:40723502-40723524 GATGAACAGGTGAGGGAGGCAGG + Intronic
906017831 1:42598218-42598240 CCTTCAAAGGTGAGGGAAGCTGG + Intronic
906479693 1:46192082-46192104 CTTTCACGTGAGTGGGAGGCAGG - Exonic
906743618 1:48206359-48206381 CAGTCACAGGTGTGTGAGGCTGG - Intergenic
908774836 1:67629729-67629751 AATACACAGGGGAAGGAGGCTGG - Intergenic
910675792 1:89815382-89815404 CATTCATAGTAGAAGCAGGCAGG + Intronic
912025262 1:105162043-105162065 GCTACTCAGGAGAGGGAGGCAGG - Intergenic
912069862 1:105796007-105796029 CAAGCACAGGAGGGGCAGGCCGG - Intergenic
913439399 1:118882040-118882062 CATTCACTGGAAATGGAGGTTGG - Intergenic
913528127 1:119712845-119712867 CCTTCGGAGGAAAGGGAGGCGGG + Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
915489047 1:156241469-156241491 CAGGCACAGGGAAGGGAGGCAGG - Intronic
917210686 1:172628959-172628981 CACTCACAGGAGACGGAAGCAGG - Intergenic
918142092 1:181727987-181728009 CACTCACAGAAGAGGGATCCAGG - Intronic
919373973 1:196768606-196768628 GCTTCACAGGAGACTGAGGCAGG + Intergenic
919897140 1:202015940-202015962 CATTCACAGGAGAAAGGAGCTGG - Exonic
920074707 1:203327639-203327661 CTTTCAGAGAAGGGGGAGGCGGG + Intergenic
920581156 1:207109129-207109151 CATGCACAGCAGAGGAATGCTGG - Intronic
922024369 1:221737029-221737051 CATCCACAGGAAAGGGAGAGAGG + Intronic
922932584 1:229402061-229402083 CATCCTTATGAGAGGGAGGCAGG - Intergenic
1063152235 10:3347314-3347336 GATTCCCAGGAGAGGGAAGGAGG - Intergenic
1063506979 10:6608473-6608495 CATACCTAGGAGAGGGAGACGGG + Intergenic
1064540617 10:16401878-16401900 GCTTCTCAGGAGATGGAGGCAGG - Intergenic
1064694847 10:17954811-17954833 CATGCAGAGGCGAGGGAGGGAGG + Intronic
1065150047 10:22813296-22813318 CATTCAAAGGAGAGAGAGGTGGG + Intergenic
1066438436 10:35415157-35415179 CACTCAGAGGAGATGGAGCCTGG + Intronic
1067792693 10:49299798-49299820 CATTCAGGGCTGAGGGAGGCTGG + Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1069479082 10:68764277-68764299 TCTACACAGGAGACGGAGGCTGG - Intronic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1072453979 10:95560759-95560781 CATCCCCTGGAGAGGGCGGCGGG - Intronic
1072943119 10:99785267-99785289 CACTCACAGTAGAAGGAGGAGGG + Intronic
1073012673 10:100373528-100373550 GATTCACAGGAGCAAGAGGCTGG - Intergenic
1073795361 10:106981815-106981837 CATTCACAGGAAAGAGGGACAGG - Intronic
1074204175 10:111267763-111267785 CATTCACAGGAATAGGAAGCTGG + Intergenic
1075242520 10:120792037-120792059 AATTCCCTGGAGAGGCAGGCTGG + Intergenic
1075521204 10:123144791-123144813 AATTCCTAGGAGAGGGAGACAGG + Intergenic
1076237575 10:128877291-128877313 GATTCACAGGTGACGGAGACAGG - Intergenic
1076511144 10:131014453-131014475 CCTTTCCAGGAGAGGGAGCCTGG + Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076671002 10:132121097-132121119 CAGTCAGAGAAGAGGCAGGCTGG + Intronic
1076886348 10:133264452-133264474 CTTTCCCAGGGTAGGGAGGCTGG + Intronic
1077011443 11:380991-381013 CATTCAGAGGAGGAGGACGCAGG - Intronic
1079156485 11:17952896-17952918 TATTGACAGGAGAGGGAGAAGGG - Intronic
1080490458 11:32757784-32757806 CATTCATATAAGAGGGAGACAGG - Intronic
1080547325 11:33333548-33333570 CATCCACTGGAGATGGAGGAAGG + Intronic
1081567946 11:44271113-44271135 CAAACACAGCAGAGGCAGGCAGG + Intronic
1082968805 11:58997044-58997066 TATCCACAGGAGAGGGGTGCAGG - Intronic
1084157359 11:67321363-67321385 CATTCTCTGGAGAGGGAGCACGG - Intronic
1084220370 11:67674250-67674272 CTTGCTCAGGAGAGGGAGGTGGG - Intronic
1084425807 11:69084047-69084069 TATGCACTGGAGTGGGAGGCTGG + Intronic
1088720949 11:112591168-112591190 CCTTCAAAGGAATGGGAGGCAGG + Intergenic
1088732207 11:112693644-112693666 CAGTCACAGGGGTGGGGGGCAGG - Intergenic
1089083931 11:115800844-115800866 CATTCACAGGAGAAGGCAGGGGG - Intergenic
1091227519 11:133966414-133966436 CATTCCAACAAGAGGGAGGCTGG + Intergenic
1091661230 12:2385325-2385347 CGTTGCCGGGAGAGGGAGGCAGG - Intronic
1092147725 12:6226267-6226289 CCTTCAGAGGAGGGGGAGCCTGG + Intronic
1095964382 12:47857231-47857253 CATTCACACGAACTGGAGGCTGG + Exonic
1096758015 12:53816262-53816284 CATGAAAAGGAGAGGGAGGTAGG - Intergenic
1097601050 12:61694216-61694238 CATTGAAAGGTGAGGAAGGCAGG - Intergenic
1099825186 12:87767265-87767287 CATTCACAAGAGAGAGAGGGAGG + Intergenic
1102472802 12:113169065-113169087 CACTGACAGGAAGGGGAGGCAGG + Intronic
1103977737 12:124714596-124714618 TTTTTACAGGAGAGGGAGGGAGG - Intergenic
1104332060 12:127856057-127856079 CATTCACAGGTGAGTCAGTCGGG + Intergenic
1104901400 12:132191205-132191227 CATTCACAGGCCCGGCAGGCTGG + Intergenic
1105773767 13:23637881-23637903 CTTTCACAGGGGCTGGAGGCCGG + Intronic
1106449317 13:29865471-29865493 CATACCCAGGAGCTGGAGGCAGG - Intergenic
1108135334 13:47351188-47351210 CTTTCCCAGGAAAGAGAGGCTGG - Intergenic
1108747945 13:53414440-53414462 TATTCAAAGGAGAGGGAAACAGG - Intergenic
1108795392 13:54024029-54024051 CAGTCACAGTAGAGGGTGGCTGG - Intergenic
1109364968 13:61342499-61342521 CATTCCCAGTAGAGGGGTGCCGG + Intergenic
1110654977 13:77987103-77987125 CATTCCCAGGACAGGTGGGCAGG + Intergenic
1110762932 13:79250741-79250763 CATTCTCAGTAAAGGGAAGCAGG - Intergenic
1111467049 13:88627336-88627358 CACTCACAGGAGAAAGAGGAAGG + Intergenic
1112227427 13:97553502-97553524 CATTCACTGGATTGGGAGGTTGG + Intergenic
1112374142 13:98823401-98823423 CATTCTCATGCCAGGGAGGCAGG - Intronic
1112558832 13:100493689-100493711 CACTCACAGGCCAGGAAGGCTGG - Intronic
1112930937 13:104737331-104737353 GGTTCACAGGAGAGGGAGGCAGG - Intergenic
1112997119 13:105587432-105587454 GATTCCCAGGAGGGTGAGGCAGG + Intergenic
1113463241 13:110496240-110496262 CATCCACAGGAGAGGAAGTCAGG + Intronic
1114529305 14:23385914-23385936 CATTCCCAGGTGAGGGGGTCAGG - Exonic
1116605077 14:46981775-46981797 CATTCACAGTAGAGAGGGGCTGG + Intronic
1118191265 14:63582788-63582810 CATGCTCAGGAGACTGAGGCAGG + Intergenic
1119595417 14:75928548-75928570 CAATCTCAGGGGAGGGAGGGAGG - Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120104452 14:80478369-80478391 CATTTCCAGGAAAGGAAGGCTGG - Intronic
1120602419 14:86527848-86527870 CATTCACAAGACAAGGAGGATGG + Intergenic
1120936048 14:89896276-89896298 CACTCACAGGAGGCCGAGGCAGG + Intronic
1122136430 14:99635473-99635495 CATCCACAGGAAAGTGGGGCTGG + Intergenic
1122173586 14:99898971-99898993 CATTCACAGGACAGGGCAGAGGG - Intronic
1122879014 14:104681742-104681764 CACTCACTGGAGAGGCAGGGTGG + Intergenic
1122898373 14:104771680-104771702 CATTCAGGGGAGGGGCAGGCTGG + Intronic
1123008931 14:105337961-105337983 CATGCACAGGAGTGGGTGGGTGG + Intronic
1126124168 15:45280330-45280352 CATACACAGGACATGGAGCCAGG - Intergenic
1127408144 15:58675084-58675106 TATTCACAGGAGGCTGAGGCAGG + Intronic
1128016946 15:64356085-64356107 CTTTCCCAGGAGCGGGAGGGAGG + Exonic
1128682341 15:69661178-69661200 CATCCACAGGAGCAGGAGGGAGG + Intergenic
1129060967 15:72859980-72860002 CATTCACTGGGGAGGGGGCCAGG + Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129382617 15:75177727-75177749 CATTCCCTGGTGAGGCAGGCAGG - Intergenic
1130520912 15:84659956-84659978 GATGCAGAGGAGAGGGAGGGGGG - Intergenic
1130937464 15:88482441-88482463 CATTCACAGGAGAGGAAGTGAGG + Intergenic
1134023943 16:10940900-10940922 CCTTCACAGAACAGGCAGGCAGG - Intronic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135651351 16:24209328-24209350 CATCCACAGGAGAGGAATGGTGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1139713397 16:68793589-68793611 CATTTATAGGAAAGGGATGCTGG + Intronic
1139749403 16:69100066-69100088 CCATCAAAGGAGAGGGAGACTGG + Intergenic
1142304178 16:89276269-89276291 CGGACACAGGAGAGGGAGACAGG + Intronic
1143205015 17:5135324-5135346 TATTCACAGGAGTGGGTGTCTGG + Intronic
1144289763 17:13815138-13815160 CATTCACTTGAGAAGGAGGCAGG - Intergenic
1144773445 17:17771960-17771982 CATTAACTGGAGATGGAGGGTGG + Intronic
1145808407 17:27750847-27750869 CACCCACAGGGGAGGGAGTCAGG - Intergenic
1146160742 17:30558322-30558344 TATTCACAGGAGTGGGTGTCTGG + Exonic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146549581 17:33768913-33768935 CTCTCAGAGGAGAGGGAAGCTGG - Intronic
1146557950 17:33842781-33842803 CATTCAGAGGAGAAGAAGGATGG + Intronic
1146835167 17:36104863-36104885 TATTCAGAGGACAGGGAAGCAGG + Intronic
1146849781 17:36212109-36212131 TATTCAGAGGACAGGGAAGCAGG + Intronic
1147366459 17:39962741-39962763 GATTGAGAGGAGAGGAAGGCAGG - Intergenic
1147437093 17:40423223-40423245 CTTTCCCAGCAGAAGGAGGCTGG + Intergenic
1148179500 17:45594015-45594037 CATTGCCAAGAGAGGCAGGCTGG - Intergenic
1148236661 17:45973746-45973768 CCTTCACAGCAGAGGCAGGAGGG - Intronic
1148269407 17:46251888-46251910 CATTGCCAAGAGAGGCAGGCTGG + Intergenic
1149438850 17:56657723-56657745 CATTCTTAGGAGAGGGAGTAAGG + Intergenic
1149846794 17:60012979-60013001 TATTCACAGGAGTGGGTGTCTGG - Intergenic
1150085144 17:62269553-62269575 TATTCACAGGAGTGGGTGTCTGG - Intergenic
1150260697 17:63788014-63788036 CCTACACAGGAGGGTGAGGCTGG - Intronic
1151157002 17:72132050-72132072 AATGCAGAGGAGAGGGAGGAGGG + Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151404104 17:73875800-73875822 GAGCCACAGGAGAGGGAAGCAGG - Intergenic
1151806319 17:76407771-76407793 TGCTCCCAGGAGAGGGAGGCTGG + Intronic
1152026927 17:77815931-77815953 CATTCACAGGGGCAGGAGGAAGG - Intergenic
1152157995 17:78647549-78647571 CATAGAGAGGAGAGAGAGGCAGG + Intergenic
1152237872 17:79147835-79147857 CATTAGCATGAGAGAGAGGCTGG - Intronic
1152730601 17:81967823-81967845 CCTGGACAGGTGAGGGAGGCTGG + Intergenic
1156419005 18:36930277-36930299 CATTCTAAGGAGAGAGAGACAGG - Intronic
1157579038 18:48762884-48762906 CATGCAGAGGAGAGGGTGGGTGG - Intronic
1157597722 18:48874095-48874117 AATTAGCAGGAGAGGGAGGCAGG + Intergenic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1157882024 18:51329663-51329685 TATTCACAGAGGAGGGAGGGAGG + Intergenic
1159438211 18:68445375-68445397 CATTGACAGATGGGGGAGGCAGG - Intergenic
1161074793 19:2280368-2280390 CATTAAAAAGAGAGAGAGGCTGG - Intronic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1163701673 19:18789537-18789559 CATCCCCAGCAGAGGGGGGCAGG + Intronic
1164588166 19:29490601-29490623 TATGCACCGCAGAGGGAGGCAGG + Intergenic
1165747411 19:38238201-38238223 CATTGACAGGAGAGAGAGTGAGG + Intergenic
1166198794 19:41222996-41223018 CATAGACAGGACAGAGAGGCCGG + Intronic
1166325870 19:42050866-42050888 CAAGCTCAGGAGAGGGAGGGAGG + Intronic
1167871839 19:52377161-52377183 CATACACAGGTCAAGGAGGCAGG - Intronic
1168290236 19:55354063-55354085 CCTCCAGGGGAGAGGGAGGCGGG - Exonic
925004814 2:433653-433675 CATTCACAGGTAACGGAGGTAGG + Intergenic
925463948 2:4089556-4089578 CATTCACAGGAAAGGGCGTTTGG - Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
927534679 2:23846038-23846060 CAGACACAGGAGGGTGAGGCGGG + Intronic
927534746 2:23846580-23846602 CAGACACAGGAGGGTGAGGCGGG + Intronic
927534813 2:23847122-23847144 CAGACACAGGAGGGTGAGGCGGG + Intronic
927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG + Exonic
928382498 2:30831257-30831279 CATTCAAAAGAGAGGGAAACAGG + Intergenic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
929777278 2:44937270-44937292 CATTCCCAAGAGAGAGGGGCTGG - Intergenic
929864568 2:45707342-45707364 AATTCACTGGAGAGGCAGGAAGG + Intronic
929945718 2:46370342-46370364 CATTCACAGAAGAGGAGGGCAGG + Intronic
930206699 2:48594123-48594145 CATTCATGGGGGAGTGAGGCAGG - Intronic
930672319 2:54164152-54164174 CATTCAGAGGAGAGGGAAGGTGG + Intronic
930694649 2:54399120-54399142 CCTTCACAGAAGAGAGGGGCTGG + Intergenic
932569985 2:72933594-72933616 CATTCACAGAAGGGGATGGCAGG - Intronic
932688612 2:73893900-73893922 TCTTCACAGGTGAGGCAGGCTGG + Intronic
932823387 2:74920147-74920169 CATTCACTGGAGAGCGAGAAGGG + Intergenic
933835290 2:86240916-86240938 CATTAACTGGTGAGGGAGGTGGG + Intronic
934936122 2:98466697-98466719 AACTCACAGGAGAGAGAGGAGGG + Intronic
934995201 2:98951142-98951164 CATTCTCAGGAGGCTGAGGCAGG + Intergenic
936574767 2:113643896-113643918 CATTCTCAGAAGAGTGAGGGGGG + Intergenic
937100649 2:119265354-119265376 CAATCACACGAAAGGCAGGCGGG + Exonic
937692602 2:124772857-124772879 CATTCAGAAGAGAAGGAGACTGG - Exonic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
940868171 2:158837592-158837614 GTTACACAGGAGAGTGAGGCTGG + Intronic
941064534 2:160886320-160886342 CATTCACAGTAGAGGAAAACAGG + Intergenic
941936369 2:170984381-170984403 TAGTTACAGGAGAGGAAGGCAGG - Intergenic
942451355 2:176109519-176109541 CATTCACCGAAGAGGAAGGAAGG - Exonic
943064359 2:183070998-183071020 CAGCCACAGGAGGGGCAGGCTGG + Intergenic
945939193 2:215931599-215931621 TGTTCACAGGAGAAGGACGCAGG + Intergenic
946009047 2:216550133-216550155 CATCCACAAAAGAGGGAGGGTGG - Intronic
946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG + Intronic
946226480 2:218266582-218266604 CATCCACTGGACAGGGAGGAAGG + Exonic
946709035 2:222487674-222487696 CTTTCACAGGAGAGACAGTCCGG + Intronic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947826507 2:233109126-233109148 CATCCACAGAAGAGCAAGGCAGG - Intronic
947909735 2:233793200-233793222 CATTCACAGGAGAGGGAGACCGG + Intronic
948736663 2:240012480-240012502 CACTTACAGGAGAGAGAGGAAGG + Intronic
1168854173 20:997270-997292 CGTCCACAGGAGAGGGAGGTGGG + Intronic
1169159067 20:3360982-3361004 CAATGACAGCAGAGGGTGGCAGG + Intronic
1169195061 20:3678444-3678466 CATCCCCAGGAGGGGAAGGCTGG - Intronic
1169205806 20:3739886-3739908 CATGGACAGGCCAGGGAGGCTGG - Intronic
1170716362 20:18834672-18834694 CATTCTCAGGAAAGGAAGGATGG - Intergenic
1170834936 20:19876017-19876039 CATTAACAGAAGAGGGAGCGAGG + Intergenic
1172481966 20:35276706-35276728 AATGAACAGGAGATGGAGGCAGG + Exonic
1173103294 20:40107608-40107630 CATTCACTGGGGAGGGAAGCTGG - Intergenic
1173282764 20:41643987-41644009 CCATCAGAGGAGAGGGAGGATGG + Intergenic
1173735340 20:45357387-45357409 CCTTCACACCAGAGGGAGTCAGG - Intergenic
1174211278 20:48880463-48880485 CATTCTAAGGATAGTGAGGCAGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1176659593 21:9621968-9621990 GATTGACAGGAGAAGGTGGCAGG + Intergenic
1178236315 21:30845983-30846005 AATCCAGAGGAGAAGGAGGCAGG + Intergenic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179949543 21:44702077-44702099 CGTTCCTATGAGAGGGAGGCAGG + Intronic
1182421126 22:30249060-30249082 CATGGACAGGAGGGGGAGGCTGG - Intergenic
1182457031 22:30458353-30458375 AATTCACAGCAGAGTGGGGCAGG - Intronic
1183067678 22:35374477-35374499 GATACTCAGGAGATGGAGGCAGG + Intergenic
1183349490 22:37326925-37326947 CACTGACGGGAGAGGGTGGCTGG - Intergenic
1183380043 22:37486121-37486143 CATGCACAGGAGGGTGAGGAGGG + Exonic
1183418420 22:37696279-37696301 AATTCACTGGACAGGGAGGAAGG - Intronic
1184917936 22:47585979-47586001 CACTCCCAGGGGAAGGAGGCTGG - Intergenic
1185425406 22:50766980-50767002 CATTCTCAGAAGAGTGAGGGGGG - Intergenic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
950144609 3:10640174-10640196 CATCCACAGGACAAGGAAGCAGG + Intronic
950464327 3:13144380-13144402 CACCCACATCAGAGGGAGGCAGG + Intergenic
950674768 3:14548114-14548136 CACTCAAAGGTGAGGTAGGCAGG + Intergenic
950698895 3:14726412-14726434 CATCCACTGCAGAGGGAGGCCGG + Intronic
951269700 3:20608784-20608806 CATCCATAGGAGAAGGAGGAAGG + Intergenic
952828044 3:37540211-37540233 CATTCACCTGGGAAGGAGGCTGG + Intronic
953069447 3:39504763-39504785 GAATCAAAGGAGTGGGAGGCAGG + Intronic
955170403 3:56558154-56558176 CAGTCAAGGGAGAGAGAGGCTGG - Intronic
955981410 3:64531253-64531275 CTTTCTCAGGTGAGGGAGGCAGG + Intronic
957215626 3:77317048-77317070 CATTCACAGTAGTGTGAAGCTGG + Intronic
958064143 3:88521168-88521190 CATACCCAGGAGTGGGATGCTGG + Intergenic
960797792 3:121506341-121506363 AATTCACTGGGGAGGGAGGTGGG + Intronic
961211142 3:125126951-125126973 CATTTACAGGTGAGGAAAGCAGG - Intronic
961435074 3:126911358-126911380 CCTTCCCAGGAGATGGAGTCTGG + Intronic
961491767 3:127261351-127261373 AAGTCACAGGGGAAGGAGGCAGG - Intergenic
961646490 3:128395420-128395442 CATTCAGAGGAGGAGGAGGAAGG - Intronic
961987586 3:131154117-131154139 GCTAGACAGGAGAGGGAGGCAGG + Intronic
962431964 3:135328175-135328197 CAATCACACTACAGGGAGGCCGG + Intergenic
962927043 3:140004480-140004502 CATTCACAGGAGCAGCAGGGAGG + Intronic
964758504 3:160111026-160111048 CAGTTACTGGGGAGGGAGGCAGG - Intergenic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965665280 3:171087349-171087371 CATTCCCAGGAGATGGACTCTGG - Exonic
966758389 3:183392841-183392863 CCTATACAGGAGTGGGAGGCAGG - Intronic
966879393 3:184341452-184341474 CACCCAGAGGAGATGGAGGCAGG - Intronic
967293152 3:187941303-187941325 CTTTCACAGGAAATGGAGGTGGG - Intergenic
967316873 3:188158054-188158076 GATTCACAGGAGAATAAGGCTGG + Intronic
967465286 3:189798016-189798038 CAGTCAAAGGATAGGGAGGAAGG - Intronic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968810554 4:2797821-2797843 CCTGCCCAGGAGTGGGAGGCTGG - Intronic
968902242 4:3437177-3437199 CCTGCACAGGAGGGCGAGGCTGG + Intronic
970476533 4:16429449-16429471 GATTCCAAAGAGAGGGAGGCAGG - Intergenic
972330036 4:38056113-38056135 GAATCAGAGGACAGGGAGGCAGG - Intronic
974984476 4:69003911-69003933 GATTCAGAGGAGAGGGTGGGAGG + Intergenic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
977258102 4:94762521-94762543 CACTCACTGGCCAGGGAGGCTGG + Intronic
981166608 4:141566364-141566386 CAGCCACAGGAGAGGATGGCAGG - Intergenic
981310710 4:143295381-143295403 GAGGTACAGGAGAGGGAGGCTGG - Intergenic
982086456 4:151841353-151841375 CTTTGACTGGAGAGGGAGCCAGG - Intergenic
984032117 4:174617173-174617195 GCTACACAGGAGACGGAGGCAGG + Intergenic
985827640 5:2204877-2204899 GAACCATAGGAGAGGGAGGCTGG + Intergenic
985942502 5:3150006-3150028 CACCCATAGGAGCGGGAGGCCGG + Intergenic
986085717 5:4443437-4443459 CATCCAGTGGAGAGCGAGGCTGG - Intergenic
986594661 5:9408917-9408939 CTCTCAGAGGAGAGGGAGGCTGG - Intronic
988711992 5:33788076-33788098 CATTCACAGGTGACCAAGGCAGG - Intronic
992118358 5:73564861-73564883 GAAGAACAGGAGAGGGAGGCGGG + Intronic
996217659 5:120888740-120888762 CATTAACAGGGGGTGGAGGCCGG - Intergenic
996635907 5:125690346-125690368 CCTTCTCAGGAGACTGAGGCAGG - Intergenic
997511795 5:134459384-134459406 CCTCCGCGGGAGAGGGAGGCAGG + Intergenic
998354299 5:141521828-141521850 GATTAAGAGGAGAGAGAGGCTGG - Intronic
998903287 5:146878142-146878164 GTCTCACAGGAGAGGGGGGCAGG + Exonic
999039725 5:148394065-148394087 TATTCACAAGAGAGGGAGAAGGG + Intronic
999352899 5:150893955-150893977 CATTCACTGGACAGGGATGTGGG - Intronic
1001156064 5:169273229-169273251 TGGCCACAGGAGAGGGAGGCAGG + Intronic
1001769518 5:174282630-174282652 CATTCCCATGAGATGGAAGCAGG - Intergenic
1001772282 5:174305436-174305458 CAGTCACAAGATAGGGAGCCAGG - Intergenic
1001868281 5:175125016-175125038 CATTGACAGGACAGGAAGGCAGG - Intergenic
1002124571 5:177033050-177033072 CAATCATAGGAAAGGGAGGTTGG - Intronic
1002544177 5:179927698-179927720 CATACTCAGGAGACTGAGGCAGG - Intronic
1003324113 6:5079727-5079749 TATTCCCAGGATAGGGAGACTGG - Intergenic
1003543967 6:7042749-7042771 CACTCTAAGGAGAGGGAGTCAGG - Intergenic
1004934163 6:20491435-20491457 CATTCCCAGGAGGGGGAGCTTGG + Exonic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008925110 6:56884017-56884039 CCTTCTCAGGAGACAGAGGCAGG + Intronic
1010239578 6:73602476-73602498 CATTAACATTAGAGGAAGGCTGG + Intronic
1010250077 6:73697926-73697948 TATTCACAGGCAAGGGAGGCTGG + Intronic
1012266211 6:97146446-97146468 CAGTCACAAGGCAGGGAGGCAGG + Exonic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1017543314 6:155425417-155425439 GACTCACAGGACAGGGATGCAGG - Intronic
1018795274 6:167180300-167180322 CAGACACAGGAGAGAAAGGCCGG - Intronic
1018836315 6:167486881-167486903 CATTCACAGGCAGGGGAGCCAGG - Intergenic
1018949530 6:168370363-168370385 CAAGCGCGGGAGAGGGAGGCCGG - Intergenic
1019384239 7:745320-745342 TGTGCACCGGAGAGGGAGGCGGG + Intronic
1019596125 7:1859188-1859210 CCTTCACACCAGGGGGAGGCAGG - Intronic
1019775575 7:2910201-2910223 CCTTCACAGGAGCGGGAGGTGGG - Intronic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020360495 7:7322167-7322189 CATTAACAGGAAATGGACGCAGG + Intergenic
1021064249 7:16154123-16154145 CATTACAAGGAGTGGGAGGCAGG - Intronic
1022139080 7:27476497-27476519 CATTCAAAAGGGAGGGAGGGAGG + Intergenic
1022413999 7:30162681-30162703 CACTCTCAGGGGAGGGAGGAGGG - Exonic
1022474547 7:30701393-30701415 ATTTCACAGGAGAGGGAGGTGGG - Intronic
1022821908 7:33970424-33970446 CGTTCTCAGGAAGGGGAGGCTGG + Intronic
1023289730 7:38656633-38656655 CAGCCACAGGAGGGGCAGGCTGG - Intergenic
1023348212 7:39293209-39293231 CATGCCAAGGAGAGGGAGGGTGG - Intronic
1023566263 7:41526590-41526612 CATAAACTGGAGAGGCAGGCAGG - Intergenic
1024602938 7:51001113-51001135 CATCCAAAGGAGAGGGAGCTGGG - Intergenic
1025997048 7:66534511-66534533 CATACTCAGGAGACTGAGGCAGG + Intergenic
1026015791 7:66669739-66669761 AAGTCACAGGAGGGGCAGGCTGG - Intronic
1028210846 7:88072719-88072741 GATTCCCAGGAGAGGGAACCTGG + Intronic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1031393586 7:121246028-121246050 CATTTATAGGATATGGAGGCTGG - Intronic
1031618044 7:123904052-123904074 CATTAACAGGAGAGGAAATCAGG - Intergenic
1032298976 7:130668972-130668994 CAGTCTCAAGAGAGCGAGGCGGG + Exonic
1032865182 7:135917698-135917720 CATCCTCAGGAGAGGGAAGCAGG + Intergenic
1033553247 7:142466457-142466479 CATTAAAAGGTGATGGAGGCTGG + Intergenic
1033608399 7:142943709-142943731 GATTCACAGGAAAGGAAGCCAGG - Intronic
1034556185 7:151851883-151851905 AGTTCACAGGAGAGGGAGCCGGG + Intronic
1034708738 7:153171456-153171478 CTTTCACAGAACAGGGAGGCTGG - Intergenic
1034946585 7:155266434-155266456 CAGTGACAGGAGGGGAAGGCAGG - Intergenic
1035194164 7:157201470-157201492 CAGCCACAGGGGAGGGAGGGCGG + Intronic
1035259348 7:157651896-157651918 CACTCAGAGGAGGGAGAGGCAGG - Intronic
1035280127 7:157773160-157773182 CACTCGCAGCAGACGGAGGCAGG + Intronic
1035876463 8:3195228-3195250 CATGCACATCAGAGGGATGCGGG + Intronic
1036519678 8:9479542-9479564 CATTAACATGAGAGAGAGCCAGG + Intergenic
1036617235 8:10397927-10397949 CATTAACAAGAGAGGGAAGAGGG - Intronic
1036688939 8:10929074-10929096 CCATCACAGGAGGGGCAGGCAGG + Intronic
1036767468 8:11557883-11557905 CACTCACACCAGAGAGAGGCTGG + Intronic
1037110922 8:15163950-15163972 CGTTTACAGGGGAAGGAGGCTGG + Intronic
1037654750 8:20873289-20873311 CATGCTAAGGAGAGAGAGGCTGG - Intergenic
1038257233 8:25961472-25961494 CCTACTCAGGAGAGTGAGGCAGG - Intronic
1038768996 8:30458821-30458843 GATACACAGGAGACTGAGGCAGG - Intronic
1039372696 8:37002730-37002752 CATTGACGGGACAGGGAGGTGGG - Intergenic
1039864109 8:41486190-41486212 CATTCCCTGGACAGAGAGGCTGG + Intergenic
1040592233 8:48804329-48804351 CCTTCAGAGGAGAGGGAGGGTGG + Intergenic
1041006660 8:53502725-53502747 CATTCACTGGAATGGGAAGCTGG - Intergenic
1042182468 8:66105228-66105250 CCTTCAAAGGGGAGGTAGGCTGG + Intergenic
1042295832 8:67216601-67216623 CACTTACAGGAGATGGAGGTGGG + Exonic
1042646765 8:70995760-70995782 TATTCACAGGAGACTGGGGCAGG - Intergenic
1043401250 8:79886574-79886596 CATTGAGAGGAGAGAGAGGTGGG + Intergenic
1044590818 8:93913149-93913171 CAGTCACAGGGGAAAGAGGCTGG - Intronic
1045318468 8:101063408-101063430 CAGTCACAGTACAGGGTGGCTGG + Intergenic
1047305039 8:123645763-123645785 TATGCACTGGAGAGTGAGGCAGG + Exonic
1048263479 8:132965238-132965260 CAATCACATGAGATGCAGGCTGG + Intronic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048648768 8:136451316-136451338 CATTGATACGAGAGGGGGGCAGG - Intergenic
1048846162 8:138605386-138605408 CATCCACAGGAGTGGGTGCCTGG + Intronic
1049266809 8:141671936-141671958 CCCTCCCAGGAGAGGGAGGCAGG - Intergenic
1049290057 8:141797134-141797156 GTTTCACAGGAGAGGGTGGTGGG + Intergenic
1049391486 8:142373805-142373827 CACACACAGGAGAGGGAGCTAGG + Intronic
1049718719 8:144105758-144105780 CATTGGCAGGTGAGGCAGGCTGG + Exonic
1055489233 9:76787868-76787890 CGGTCACAGGAGAGGAAGTCGGG - Intronic
1057562567 9:96139961-96139983 CACCCACAGGAGAGGCAGACCGG - Intergenic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1057928170 9:99170992-99171014 TATGCACAGGAAAGGAAGGCTGG - Intergenic
1058954026 9:109929258-109929280 CATTCAAATAAGATGGAGGCTGG - Intronic
1060319682 9:122545948-122545970 AATTCTCAGGACAGGGAGGAGGG - Intergenic
1060528258 9:124332640-124332662 ATTTCACAGGAAGGGGAGGCTGG - Intronic
1060612877 9:124984404-124984426 CACTTACAGGAGAGCGAGGAAGG + Intronic
1061429176 9:130520325-130520347 CATTCACAGCAGTGGGCAGCAGG - Intergenic
1061801834 9:133116962-133116984 AATTCGCAGGGGAGGGTGGCAGG + Intronic
1061858480 9:133455915-133455937 CCTTCTCAGGACAGGGAGGGGGG - Intronic
1062259613 9:135654928-135654950 AATGCACAGGAGAGGCGGGCAGG - Intergenic
1062404058 9:136385937-136385959 CATTCACAAGAGTGAAAGGCCGG - Intronic
1203637152 Un_KI270750v1:123811-123833 GATTGACAGGAGAAGGTGGCAGG + Intergenic
1186427805 X:9477996-9478018 CATCCCCAGGAGAGGAAGGTGGG + Intronic
1186683239 X:11897881-11897903 AATTGAAAGGAGAGGAAGGCTGG + Intergenic
1189241189 X:39525994-39526016 CATTCACAGGCAAGGGAGCTGGG - Intergenic
1192016002 X:67331921-67331943 AATTCACAGGGGATGGGGGCAGG - Intergenic
1192161109 X:68788472-68788494 CACACACTGGAGAGGGATGCAGG + Intergenic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1193123519 X:77847720-77847742 CTTACTCAGGAGACGGAGGCAGG - Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1196869053 X:120095934-120095956 CAATGACAGGGGAGGGAGGCAGG + Intergenic
1198442356 X:136675438-136675460 AATTTAAAGGAGAGGAAGGCTGG - Intronic
1199834812 X:151578727-151578749 CACTCAGAGGAGAGGGAGAGGGG - Intronic
1200184378 X:154172597-154172619 CAATCACATGACAGGGAGGGAGG - Intergenic
1200190030 X:154209730-154209752 CAATCACATGACAGGGAGGGAGG - Intergenic
1200195783 X:154247539-154247561 CAATCACATGACAGGGAGGGAGG - Intergenic
1200201437 X:154284655-154284677 CAATCACATGACAGGGAGGGAGG - Intronic